Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog HrcA - Caulobacterales

Properties
Regulator type: Transcription factor
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Phylum: Proteobacteria/alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Caulobacter crescentus CB15 2 1
Caulobacter segnis ATCC 21756 2 1
Caulobacter sp. K31 2 1
Phenylobacterium zucineum HLK1 2 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
groS
*
Caulobacter crescentus CB15

Site:
position = -86
score = 7.10614
sequence = TTGGCACTCGAATGGAGCGACTGCTAA

Gene: CC0686: Heat shock protein 60 family co-chaperone GroES
*
Caulobacter segnis ATCC 21756

Site:
position = -87
score = 7.30835
sequence = TTAGCACTCGGAGGGAGCGACTGCTAA

Gene: Cseg_3693: Heat shock protein 60 family co-chaperone GroES
*
Caulobacter sp. K31

Site:
position = -88
score = 7.39119
sequence = TTGGCACTCGATGGGAGCGACTGCTAA

Gene: Caul_4151: Heat shock protein 60 family co-chaperone GroES
*2
Phenylobacterium zucineum HLK1

Gene: PHZ_p0096: Heat shock protein 60 family co-chaperone GroES

Site:
position = -93
score = 6.90073
sequence = TTAGCACTCAAGGGCCGAGACTGCTAA

Gene: PHZ_c3181: Heat shock protein 60 family co-chaperone GroES
Heat shock protein 60 family co-chaperone GroES
groL
 
Caulobacter crescentus CB15

Gene: CC0685: Heat shock protein 60 family chaperone GroEL
 
Caulobacter segnis ATCC 21756

Gene: Cseg_3694: Heat shock protein 60 family chaperone GroEL
 
Caulobacter sp. K31

Gene: Caul_4150: Heat shock protein 60 family chaperone GroEL
 2
Phenylobacterium zucineum HLK1

Gene: PHZ_p0095: Heat shock protein 60 family chaperone GroEL

Gene: PHZ_c3182: Heat shock protein 60 family chaperone GroEL
Heat shock protein 60 family chaperone GroEL
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD