Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog HrcA - Sphingomonadales

Properties
Regulator type: Transcription factor
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Phylum: Proteobacteria/alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Erythrobacter litoralis HTCC2594 2 1
Erythrobacter sp. NAP1 2 1
Novosphingobium aromaticivorans DSM 12444 2 1
Sphingopyxis alaskensis RB2256 2 1
Sphingobium japonicum UT26S 2 1
Sphingomonas wittichii RW1 2 1
Zymomonas mobilis subsp. mobilis ZM4 2 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
groS
*
Erythrobacter litoralis HTCC2594

Site:
position = -64
score = 7.24169
sequence = CTGGCACTCTCTGGACGAGAGTGCCAA

Gene: ELI_14405: Heat shock protein 60 family co-chaperone GroES
*
Erythrobacter sp. NAP1

Site:
position = -63
score = 7.03604
sequence = CTGGCACTCTTATGCCAAGAGTGCCAA

Gene: NAP1_11773: Heat shock protein 60 family co-chaperone GroES
*
Novosphingobium aromaticivorans DSM 12444

Site:
position = -61
score = 7.32406
sequence = CTGGCACTCTCGGGTTGAGAGTGCCAA

Gene: Saro_0034: Heat shock protein 60 family co-chaperone GroES
*
Sphingopyxis alaskensis RB2256

Site:
position = -59
score = 6.95142
sequence = TTAGCACTCTCCTGTGGCGAGTGCTAA

Gene: Sala_0453: Heat shock protein 60 family co-chaperone GroES
*
Sphingobium japonicum UT26S

Site:
position = -120
score = 6.96335
sequence = CTGGCACTCCCCGACGAGGAGTGCTAA

Gene: SJA_C1-21260: Heat shock protein 60 family co-chaperone GroES
*
Sphingomonas wittichii RW1

Site:
position = -100
score = 6.44354
sequence = CTGGCACTCGCTTCCGGTGAGTGCTAA

Gene: Swit_3375: Heat shock protein 60 family co-chaperone GroES
*
Zymomonas mobilis subsp. mobilis ZM4

Site:
position = 10
score = 6.51922
sequence = TTGGCACTTCGCAAGGGAGAGTGCCAG

Gene: ZMO1928: Heat shock protein 60 family co-chaperone GroES
Heat shock protein 60 family co-chaperone GroES
groL
 
Erythrobacter litoralis HTCC2594

Gene: ELI_14400: Heat shock protein 60 family chaperone GroEL
 
Erythrobacter sp. NAP1

Gene: NAP1_11778: Heat shock protein 60 family chaperone GroEL
 
Novosphingobium aromaticivorans DSM 12444

Gene: Saro_0035: Heat shock protein 60 family chaperone GroEL
 
Sphingopyxis alaskensis RB2256

Gene: Sala_0452: Heat shock protein 60 family chaperone GroEL
 
Sphingobium japonicum UT26S

Gene: SJA_C1-21250: Heat shock protein 60 family chaperone GroEL
 
Sphingomonas wittichii RW1

Gene: Swit_3376: Heat shock protein 60 family chaperone GroEL
 
Zymomonas mobilis subsp. mobilis ZM4

Gene: ZMO1929: Heat shock protein 60 family chaperone GroEL
Heat shock protein 60 family chaperone GroEL
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD