Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog HrcA - Rhodospirillales

Properties
Regulator type: Transcription factor
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Phylum: Proteobacteria/alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 9 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Rhodospirillum rubrum ATCC 11170 2 1
Magnetospirillum magnetotacticum MS-1 2 1
Magnetospirillum magneticum AMB-1 1 1
Azospirillum sp. B510 2 1
Rhodospirillum centenum SW 2 1
Gluconacetobacter diazotrophicus PAl 5 2 1
Acetobacter pasteurianus IFO 3283-01 2 1
Gluconobacter oxydans 621H 2 1
Granulibacter bethesdensis CGDNIH1 2 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
groS
*2
Rhodospirillum rubrum ATCC 11170

Gene: Rru_A0161: Heat shock protein 60 family co-chaperone GroES

Site:
position = -94
score = 7.38718
sequence = TTAGCACTCGCCGGGTGGGAGTGCTAA

Gene: Rru_A0586: Heat shock protein 60 family co-chaperone GroES
*
Magnetospirillum magnetotacticum MS-1

Site:
position = -73
score = 7.26909
sequence = TTGGCACTCGTCGCCGGAGAGTGCTAA

Gene: Magn03009934: Heat shock protein 60 family co-chaperone GroES
 
Magnetospirillum magneticum AMB-1
*
Azospirillum sp. B510

Site:
position = -90
score = 7.20853
sequence = CTGGCACTCGCCGGGCGGGAGTGCTAA

Gene: AZL_003450: Heat shock protein 60 family co-chaperone GroES
*
Rhodospirillum centenum SW

Site:
position = -73
score = 7.27551
sequence = CTGGCACTCACCGCGGGTGAGTGCTAA

Gene: RC1_2594: Heat shock protein 60 family co-chaperone GroES
*2
Gluconacetobacter diazotrophicus PAl 5

Site:
position = -109
score = 7.28062
sequence = CTGGCACTCTCGTGCGGAGAGTGCCAA

Gene: Gdia_0272: Heat shock protein 60 family co-chaperone GroES

Gene: Gdia_0862: Heat shock protein 60 family co-chaperone GroES
*
Acetobacter pasteurianus IFO 3283-01

Site:
position = -41
score = 7.23115
sequence = CTGGCACTCCCGGGGTGGGAGTGCTAA

Gene: APA01_17860: Heat shock protein 60 family co-chaperone GroES
*
Gluconobacter oxydans 621H

Site:
position = -92
score = 7.12234
sequence = TTGGCACTCTCCATGTGAGAGTGCCAA

Gene: GOX1901: Heat shock protein 60 family co-chaperone GroES
*
Granulibacter bethesdensis CGDNIH1

Site:
position = -69
score = 7.32891
sequence = CTGGCACTCCCCGCATGGGAGTGCTAA

Gene: GbCGDNIH1_2181: Heat shock protein 60 family co-chaperone GroES
Heat shock protein 60 family co-chaperone GroES
groL
 2
Rhodospirillum rubrum ATCC 11170

Gene: Rru_A0587: Heat shock protein 60 family chaperone GroEL

Gene: Rru_A0162: Heat shock protein 60 family chaperone GroEL
 
Magnetospirillum magnetotacticum MS-1

Gene: Magn03009933: Heat shock protein 60 family chaperone GroEL
*
Magnetospirillum magneticum AMB-1

Site:
position = -388
score = 7.26909
sequence = TTGGCACTCGTCGCCGGAGAGTGCTAA

Gene: amb0203: Heat shock protein 60 family chaperone GroEL
 
Azospirillum sp. B510

Gene: AZL_003460: Heat shock protein 60 family chaperone GroEL
 
Rhodospirillum centenum SW

Gene: RC1_2595: Heat shock protein 60 family chaperone GroEL
 2
Gluconacetobacter diazotrophicus PAl 5

Gene: Gdia_0861: Heat shock protein 60 family chaperone GroEL

Gene: Gdia_0271: Heat shock protein 60 family chaperone GroEL
 
Acetobacter pasteurianus IFO 3283-01

Gene: APA01_17870: Heat shock protein 60 family chaperone GroEL
 
Gluconobacter oxydans 621H

Gene: GOX1902: Heat shock protein 60 family chaperone GroEL
 
Granulibacter bethesdensis CGDNIH1

Gene: GbCGDNIH1_2180: Heat shock protein 60 family chaperone GroEL
Heat shock protein 60 family chaperone GroEL
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD