Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog HrcA - Rhodobacterales

Properties
Regulator type: Transcription factor
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Phylum: Proteobacteria/alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 15 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Rhodobacter sphaeroides 2.4.1 2 1
Paracoccus denitrificans PD1222 1 1
Jannaschia sp. CCS1 2 1
Rhodobacterales bacterium HTCC2654 2 1
Oceanicola granulosus HTCC2516 2 1
Loktanella vestfoldensis SKA53 2 1
Oceanicola batsensis HTCC2597 2 1
Roseovarius nubinhibens ISM 2 1
Roseovarius sp. 217 2 1
Sulfitobacter sp. EE-36 2 1
Silicibacter TM1040 2 1
Silicibacter pomeroyi DSS-3 2 1
Roseobacter sp. MED193 2 1
Hyphomonas neptunium ATCC 15444 2 1
Oceanicaulis alexandrii HTCC2633 2 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
groS
*
Rhodobacter sphaeroides 2.4.1

Site:
position = -62
score = 7.47934
sequence = TTGGCACTCGCCTCGGGTGAGTGCTAA

Gene: RSP_2310: Heat shock protein 60 family co-chaperone GroES
 
Paracoccus denitrificans PD1222

Gene: Pden_4586: Heat shock protein 60 family co-chaperone GroES
*
Jannaschia sp. CCS1

Site:
position = -72
score = 6.87594
sequence = TTGGCACTCGCGTTCGGTGAGTGCTAA

Gene: Jann_3359: Heat shock protein 60 family co-chaperone GroES
*
Rhodobacterales bacterium HTCC2654

Site:
position = -86
score = 7.44085
sequence = TTAGCACTCACCCCCGGTGAGTGCCAA

Gene: RB2654_08122: Heat shock protein 60 family co-chaperone GroES
*
Oceanicola granulosus HTCC2516

Site:
position = -54
score = 7.46222
sequence = TTAGCACTCACACCGAGCGAGTGCTAA

Gene: OG2516_17151: Heat shock protein 60 family co-chaperone GroES
*
Loktanella vestfoldensis SKA53

Site:
position = -60
score = 7.06707
sequence = TTGGCACTCGGACTGGCTGAGTGCTAA

Gene: SKA53_08661: Heat shock protein 60 family co-chaperone GroES
*
Oceanicola batsensis HTCC2597

Site:
position = -94
score = 7.14612
sequence = TTAGCACTCGCGTGGTGTGAGTGATAA

Gene: OB2597_07485: Heat shock protein 60 family co-chaperone GroES
*
Roseovarius nubinhibens ISM

Site:
position = -79
score = 7.23806
sequence = TTAGCACTCGGAGGGACTGAGTGCTAA

Gene: ISM_05760: Heat shock protein 60 family co-chaperone GroES
*
Roseovarius sp. 217

Site:
position = -81
score = 6.9919
sequence = TTAGCACTCGAACCCCATGAGTGCTAA

Gene: ROS217_12501: Heat shock protein 60 family co-chaperone GroES
*
Sulfitobacter sp. EE-36

Site:
position = -92
score = 7.56521
sequence = TTAGCACTCGGCAGGGCTGAGTGCTAA

Gene: EE36_03888: Heat shock protein 60 family co-chaperone GroES
*
Silicibacter TM1040

Site:
position = -94
score = 7.45218
sequence = TTAGCACTCGACTGAGGTGAGTGCTAA

Gene: TM1040_0596: Heat shock protein 60 family co-chaperone GroES
*
Silicibacter pomeroyi DSS-3

Site:
position = -86
score = 7.18488
sequence = TTAGCACTCGTCAGACCTGAGTGCTAA

Gene: SPO0886: Heat shock protein 60 family co-chaperone GroES
*
Roseobacter sp. MED193

Site:
position = -93
score = 7.05966
sequence = TTAGCACTCATCAGGTGTGAGTGATAA

Gene: MED193_20209: Heat shock protein 60 family co-chaperone GroES
*
Hyphomonas neptunium ATCC 15444

Site:
position = -110
score = 7.35483
sequence = TTAGCAGTCGGCTCGGGCGAGTGCTAA

Gene: HNE_1961: Heat shock protein 60 family co-chaperone GroES
*
Oceanicaulis alexandrii HTCC2633

Site:
position = -94
score = 6.40188
sequence = TTAGCAGCCAGGGCAGGAGAGTGCTAA

Gene: OA2633_05922: Heat shock protein 60 family co-chaperone GroES
Heat shock protein 60 family co-chaperone GroES
groL
 2
Rhodobacter sphaeroides 2.4.1

Gene: RSP_2311: Heat shock protein 60 family chaperone GroEL

Gene: RSP_3615: Heat shock protein 60 family chaperone GroEL
*2
Paracoccus denitrificans PD1222

Site:
position = -396
score = 7.16837
sequence = TTGGCACTCACCCGAGCCGAGTGCCAA

Gene: Pden_3654: Heat shock protein 60 family chaperone GroEL

Gene: Pden_4585: Heat shock protein 60 family chaperone GroEL
 
Jannaschia sp. CCS1

Gene: Jann_3358: Heat shock protein 60 family chaperone GroEL
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_08117: Heat shock protein 60 family chaperone GroEL
 
Oceanicola granulosus HTCC2516

Gene: OG2516_17146: Heat shock protein 60 family chaperone GroEL
 
Loktanella vestfoldensis SKA53

Gene: SKA53_08666: Heat shock protein 60 family chaperone GroEL
 
Oceanicola batsensis HTCC2597

Gene: OB2597_07480: Heat shock protein 60 family chaperone GroEL
 
Roseovarius nubinhibens ISM

Gene: ISM_05755: Heat shock protein 60 family chaperone GroEL
 
Roseovarius sp. 217

Gene: ROS217_12506: Heat shock protein 60 family chaperone GroEL
 
Sulfitobacter sp. EE-36

Gene: EE36_03883: Heat shock protein 60 family chaperone GroEL
 
Silicibacter TM1040

Gene: TM1040_0597: Heat shock protein 60 family chaperone GroEL
 
Silicibacter pomeroyi DSS-3

Gene: SPO0887: Heat shock protein 60 family chaperone GroEL
 
Roseobacter sp. MED193

Gene: MED193_20214: Heat shock protein 60 family chaperone GroEL
 
Hyphomonas neptunium ATCC 15444

Gene: HNE_1962: Heat shock protein 60 family chaperone GroEL
 
Oceanicaulis alexandrii HTCC2633

Gene: OA2633_05927: Heat shock protein 60 family chaperone GroEL
Heat shock protein 60 family chaperone GroEL
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD