Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog HrcA - Rhizobiales

Properties
Regulator type: Transcription factor
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Phylum: Proteobacteria/alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 38 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Sinorhizobium meliloti 1021 4 2
Rhizobium sp. NGR234 6 3
Rhizobium leguminosarum bv. viciae 3841 6 3
Rhizobium etli CFN 42 8 4
Agrobacterium tumefaciens str. C58 (Cereon) 2 1
Mesorhizobium sp. BNC1 4 2
Mesorhizobium loti MAFF303099 10 5
Brucella melitensis 16M 2 1
Bartonella quintana str. Toulouse 2 1
Rhodopseudomonas palustris CGA009 4 2
Bradyrhizobium japonicum USDA 110 7 4
Bradyrhizobium sp. BTAi1 6 3
Nitrobacter winogradskyi Nb-255 6 3
Azorhizobium caulinodans ORS 571 4 2
Xanthobacter autotrophicus Py2 4 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
groS
*3
Sinorhizobium meliloti 1021

Site:
position = -85
score = 6.72147
sequence = CTAGCACTCGCTTGATATGAGTGCTAA

Gene: SMc00912: Heat shock protein 60 family co-chaperone GroES

Site:
position = -83
score = 6.857
sequence = CTAGCACTCTCGCGTGAAGAGTGCTAA

Gene: SMa0745: Heat shock protein 60 family co-chaperone GroES

Gene: SMa0125: Heat shock protein 60 family co-chaperone GroES
*3
Rhizobium sp. NGR234

Site:
position = -178
score = 6.77949
sequence = GTAGCACTCTCAAGTGGCGAGTGCTAA

Gene: NGR_b05810: Heat shock protein 60 family co-chaperone GroES

Site:
position = -175
score = 6.7568
sequence = TTAGCACTCCATGTGATGGAGTGCTAA

Gene: NGR_b05110: Heat shock protein 60 family co-chaperone GroES

Site:
position = -85
score = 6.77934
sequence = CTAGCACTCTTTAAGAAGGAGTGCTAA

Gene: NGR_c04090: Heat shock protein 60 family co-chaperone GroES
*3
Rhizobium leguminosarum bv. viciae 3841

Site:
position = -85
score = 6.85052
sequence = CTAGCACTCACCGCAAGGGAGTGCTAA

Gene: RL0884: Heat shock protein 60 family co-chaperone GroES

Site:
position = -81
score = 6.11241
sequence = TTGGCACTCCTATCAATCGAGTGCCAC

Gene: RL1410: Heat shock protein 60 family co-chaperone GroES

Site:
position = -172
score = 6.77535
sequence = CTAGCACTCGCGGGCAGGGAGTGCCAA

Gene: pRL120643: Heat shock protein 60 family co-chaperone GroES
*4
Rhizobium etli CFN 42

Site:
position = -81
score = 6.11241
sequence = TTGGCACTCCTATCAATCGAGTGCCAC

Gene: RHE_CH01270: Heat shock protein 60 family co-chaperone GroES

Site:
position = -85
score = 6.85052
sequence = CTAGCACTCACCGCAAGGGAGTGCTAA

Gene: RHE_CH00829: Heat shock protein 60 family co-chaperone GroES

Site:
position = -177
score = 5.97736
sequence = TTAGCAGCCACTTCGAGTGAGTGCTAA

Gene: RHE_CH01238: Heat shock protein 60 family co-chaperone GroES

Site:
position = -169
score = 6.76276
sequence = TTAGCAGTCGTCGATAGAGAGTGCTAA

Gene: RHE_PF00329: Heat shock protein 60 family co-chaperone GroES
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -85
score = 6.63924
sequence = CTGGCACTCCAACAAGGGGAGTGCTAA

Gene: Atu0683: Heat shock protein 60 family co-chaperone GroES
*2
Mesorhizobium sp. BNC1

Site:
position = -167
score = 6.85575
sequence = TTGGCACTCTCAATAGGTGAGTGCTAA

Gene: Meso_3096: Heat shock protein 60 family co-chaperone GroES

Site:
position = -94
score = 7.1918
sequence = TTAGCACTCTCCTACAGCGAGTGCTAA

Gene: Meso_0358: Heat shock protein 60 family co-chaperone GroES
*5
Mesorhizobium loti MAFF303099

Site:
position = -183
score = 6.69188
sequence = CTAGCACTCTCGCACGCCGAGTGCCAA

Gene: mlr2393: Heat shock protein 60 family co-chaperone GroES

Site:
position = -80
score = 6.49134
sequence = TTGGCACTCCTATCTATCGAGTGCCAA

Gene: mll2233: Heat shock protein 60 family co-chaperone GroES

Site:
position = -79
score = 7.21416
sequence = TTAGCACTCCCCAATAGCGAGTGCTAA

Gene: msl5812: Heat shock protein 60 family co-chaperone GroES

Site:
position = -81
score = 7.08675
sequence = TTAGCACTCGCCTCTGCCGAGTGCTAA

Gene: msr9341: Heat shock protein 60 family co-chaperone GroES

Site:
position = -91
score = 7.19899
sequence = TTAGCACTCGCCCTTGGTGAGTGCTAA

Gene: mll8202: Heat shock protein 60 family co-chaperone GroES
*
Brucella melitensis 16M

Site:
position = -87
score = 6.72963
sequence = TTAGCACTCGGACGAATAGAGTGCTAA

Gene: BMEII1047: Heat shock protein 60 family co-chaperone GroES
*
Bartonella quintana str. Toulouse

Site:
position = -76
score = 6.93709
sequence = TTAGCACTCTCCAACTATGAGTGCTAA

Gene: BQ10760: Heat shock protein 60 family co-chaperone GroES
*2
Rhodopseudomonas palustris CGA009

Site:
position = -69
score = 6.21939
sequence = CTGGCACTCTTCGCCCGCGACTGCCAA

Gene: RPA2165: Heat shock protein 60 family co-chaperone GroES

Site:
position = -109
score = 6.46992
sequence = TTAGCACTCTTGCAGTACGACTGCCAA

Gene: RPA1141: Heat shock protein 60 family co-chaperone GroES
*5
Bradyrhizobium japonicum USDA 110

Site:
position = -119
score = 6.46121
sequence = TTAGCACTCGGAAAGCCCGATTGCTAA

Gene: bsr7532: Heat shock protein 60 family co-chaperone GroES

Gene: bll2060: Heat shock protein 60 family co-chaperone GroES

Site:
position = -70
score = 6.38321
sequence = CTAGCACTCGCGGGCACAGACTGCTAA

Gene: blr5625: Heat shock protein 60 family co-chaperone GroES

Site:
position = -59
score = 5.5269
sequence = TCAGCACTCGCTAGCTTCGACTGCTAT

Gene: blr6978: Heat shock protein 60 family co-chaperone GroES

Site:
position = -137
score = 5.37113
sequence = TTGGCAGTCAGACGGCCGGAGTGACAA

Gene: blr5226: Heat shock protein 60 family co-chaperone GroES
*4
Bradyrhizobium sp. BTAi1

Site:
position = -71
score = 6.39607
sequence = CTGGCACTCGCCGGCAGCGACTGCCAA

Gene: BBta_5284: Heat shock protein 60 family co-chaperone GroES

Site:
position = -126
score = 6.52922
sequence = TTAGCACTCGGAGGGCACGATTGCTAA

Gene: BBta_1672: Heat shock protein 60 family co-chaperone GroES

Gene: BBta_2520: Heat shock protein 60 family co-chaperone GroES

Site:
position = -143
score = 6.09089
sequence = CTGGCAATCGTTCCCACCGAGTGCCAA

Gene: BBta_3033: Heat shock protein 60 family co-chaperone GroES
*3
Nitrobacter winogradskyi Nb-255

Site:
position = -70
score = 5.83103
sequence = CTGGCACTCGCTGGTATTGACTGCCAG

Gene: Nwi_2191: Heat shock protein 60 family co-chaperone GroES

Site:
position = -117
score = 5.99113
sequence = GTGGCACTCTCGCAATACGATTGCCAA

Gene: Nwi_2573: Heat shock protein 60 family co-chaperone GroES

Site:
position = -144
score = 5.84128
sequence = TTGGCGCTCCAGGGCGCGGAGTGCCAA

Gene: Nwi_2114: Heat shock protein 60 family co-chaperone GroES
*2
Azorhizobium caulinodans ORS 571

Site:
position = -184
score = 6.65429
sequence = TTGGCACTCATGGGAGAGGAGTGCTAA

Gene: AZC_2311: Heat shock protein 60 family co-chaperone GroES

Site:
position = -71
score = 6.507
sequence = TTGGCACTCCCATCCGGTGAGTGCCAG

Gene: AZC_0425: Heat shock protein 60 family co-chaperone GroES
*2
Xanthobacter autotrophicus Py2

Site:
position = -138
score = 6.83215
sequence = CTAGCACTCCACATCCGCGAGTGCTAA

Gene: Xaut_4265: Heat shock protein 60 family co-chaperone GroES

Site:
position = -71
score = 6.55975
sequence = TTGGCACTCCACCTTGGAGAGTGCCAG

Gene: Xaut_1165: Heat shock protein 60 family co-chaperone GroES
Heat shock protein 60 family co-chaperone GroES
groL
 3
Sinorhizobium meliloti 1021

Gene: SMa0744: Heat shock protein 60 family chaperone GroEL

Gene: SMc00913: Heat shock protein 60 family chaperone GroEL

Gene: SMa0124: Heat shock protein 60 family chaperone GroEL
 3
Rhizobium sp. NGR234

Gene: NGR_b05820: Heat shock protein 60 family chaperone GroEL

Gene: NGR_b05100: Heat shock protein 60 family chaperone GroEL

Gene: NGR_c04080: Heat shock protein 60 family chaperone GroEL
 3
Rhizobium leguminosarum bv. viciae 3841

Gene: RL1412: Heat shock protein 60 family chaperone GroEL

Gene: RL0883: Heat shock protein 60 family chaperone GroEL

Gene: pRL120642: Heat shock protein 60 family chaperone GroEL
 4
Rhizobium etli CFN 42

Gene: RHE_CH01271: Heat shock protein 60 family chaperone GroEL

Gene: RHE_CH00828: Heat shock protein 60 family chaperone GroEL

Gene: RHE_CH01239: Heat shock protein 60 family chaperone GroEL

Gene: RHE_PF00330: Heat shock protein 60 family chaperone GroEL
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu0682: Heat shock protein 60 family chaperone GroEL
 2
Mesorhizobium sp. BNC1

Gene: Meso_3095: Heat shock protein 60 family chaperone GroEL

Gene: Meso_0357: Heat shock protein 60 family chaperone GroEL
 5
Mesorhizobium loti MAFF303099

Gene: mlr2394: Heat shock protein 60 family chaperone GroEL

Gene: mll2232: Heat shock protein 60 family chaperone GroEL

Gene: mll5810: Heat shock protein 60 family chaperone GroEL

Gene: mlr9342: Heat shock protein 60 family chaperone GroEL

Gene: mll8201: Heat shock protein 60 family chaperone GroEL
 
Brucella melitensis 16M

Gene: BMEII1048: Heat shock protein 60 family chaperone GroEL
 
Bartonella quintana str. Toulouse

Gene: BQ10750: Heat shock protein 60 family chaperone GroEL
 2
Rhodopseudomonas palustris CGA009

Gene: RPA2164: Heat shock protein 60 family chaperone GroEL

Gene: RPA1140: Heat shock protein 60 family chaperone GroEL
 5
Bradyrhizobium japonicum USDA 110

Gene: blr6979: Heat shock protein 60 family chaperone GroEL

Gene: bll2059: Heat shock protein 60 family chaperone GroEL

Gene: blr5626: Heat shock protein 60 family chaperone GroEL

Gene: blr7533: Heat shock protein 60 family chaperone GroEL

Gene: blr5227: Heat shock protein 60 family chaperone GroEL
 4
Bradyrhizobium sp. BTAi1

Gene: BBta_5285: Heat shock protein 60 family chaperone GroEL

Gene: BBta_1671: Heat shock protein 60 family chaperone GroEL

Gene: BBta_2521: Heat shock protein 60 family chaperone GroEL

Gene: BBta_3034: Heat shock protein 60 family chaperone GroEL
 3
Nitrobacter winogradskyi Nb-255

Gene: Nwi_2574: Heat shock protein 60 family chaperone GroEL

Gene: Nwi_2192: Heat shock protein 60 family chaperone GroEL

Gene: Nwi_2113: Heat shock protein 60 family chaperone GroEL
 2
Azorhizobium caulinodans ORS 571

Gene: AZC_2312: Heat shock protein 60 family chaperone GroEL

Gene: AZC_0424: Heat shock protein 60 family chaperone GroEL
 2
Xanthobacter autotrophicus Py2

Gene: Xaut_4264: Heat shock protein 60 family chaperone GroEL

Gene: Xaut_1166: Heat shock protein 60 family chaperone GroEL
Heat shock protein 60 family chaperone GroEL
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD