Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog HrcA - Various betaproteobacteria

Properties
Regulator type: Transcription factor
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Phylum: Proteobacteria/beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 22 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Azoarcus sp. EbN1 3 2
Thauera sp. MZ1T 3 2
Dechloromonas aromatica RCB 3 2
Nitrosomonas europaea ATCC 19718 3 2
Nitrosospira multiformis ATCC 25196 2 1
Thiobacillus denitrificans 3 2
Chromobacterium violaceum ATCC 12472 3 2
Neisseria meningitidis MC58
Laribacter hongkongensis HLHK9 5 3
Methylobacillus flagellatus KT 3 2
Methylotenera mobilis JLW8 3 2
Methylophilales bacterium HTCC2181 3 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
rpoH
*
Azoarcus sp. EbN1

Site:
position = -54
score = 6.96387
sequence = TTAGCACTCCAACGCCATGAGTGCTAA

Gene: ebA4241: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
*
Thauera sp. MZ1T

Site:
position = -55
score = 7.05114
sequence = TTAGCACTCTCACGCCCCGAGTGCTAA

Gene: Tmz1t_1062: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
*
Dechloromonas aromatica RCB

Site:
position = -61
score = 7.08157
sequence = TTAGCACTCTTATGCAGCGAGTGCTAA

Gene: Daro_3837: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
*
Nitrosomonas europaea ATCC 19718

Site:
position = -85
score = 6.99508
sequence = TTAGCACTCATGAACTAAGAGTGCTAG

Gene: NE0584: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
 
Nitrosospira multiformis ATCC 25196

Gene: Nmul_A2741: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
*
Thiobacillus denitrificans

Site:
position = -52
score = 6.99845
sequence = TTAGCACTCCCAATGCGCGAGTGCTAA

Gene: Tbd_0345: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
*
Chromobacterium violaceum ATCC 12472

Site:
position = -58
score = 6.81209
sequence = CTAGCACTCTCAATATTCGAGTGCTAA

Gene: CV4206: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
 
Neisseria meningitidis MC58

Gene: NMB0712: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
*
Laribacter hongkongensis HLHK9

Site:
position = -55
score = 6.65395
sequence = TTATCACTCAACCAGGCCGAGTGCTAA

Gene: LHK_00231: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
*
Methylobacillus flagellatus KT

Site:
position = -55
score = 6.3191
sequence = CTAGCACACTCAAACAGTGAGTGCTAG

Gene: Mfla_0702: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
*
Methylotenera mobilis JLW8

Site:
position = -56
score = 7.00953
sequence = CTAGCACTCTCGAACGTAGAGTGCTAA

Gene: Mmol_1814: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
*
Methylophilales bacterium HTCC2181

Site:
position = -47
score = 7.12541
sequence = TTAGCACTCTATAGGATTGAGTGCTAA

Gene: MB2181_02680: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
 
CRON 2.
groS
*
Azoarcus sp. EbN1

Site:
position = -115
score = 7.3516
sequence = TTAGCACTCGTTGGCAGTGAGTGCTAA

Gene: ebB35: Heat shock protein 60 family co-chaperone GroES
*
Thauera sp. MZ1T

Site:
position = -144
score = 7.47097
sequence = TTAGCACTCGTTGGCGTCGAGTGCTAA

Gene: Tmz1t_1419: Heat shock protein 60 family co-chaperone GroES
*
Dechloromonas aromatica RCB

Site:
position = -115
score = 7.44827
sequence = TTAGCACTCACCGGCGACGAGTGCTAA

Gene: Daro_0425: Heat shock protein 60 family co-chaperone GroES
*
Nitrosomonas europaea ATCC 19718

Site:
position = -128
score = 7.36348
sequence = TTAGCACTCGTTGCTGTTGAGTGCTAA

Gene: NE0027: Heat shock protein 60 family co-chaperone GroES
*
Nitrosospira multiformis ATCC 25196

Site:
position = -120
score = 7.28056
sequence = TTAGCACTCATTGGCATTGAGTGCTAA

Gene: Nmul_A2345: Heat shock protein 60 family co-chaperone GroES
*
Thiobacillus denitrificans

Site:
position = -102
score = 6.8201
sequence = TCAGCACTCTATGGCGGCGAGTGCTAA

Gene: Tbd_0092: Heat shock protein 60 family co-chaperone GroES
*
Chromobacterium violaceum ATCC 12472

Site:
position = -94
score = 7.34972
sequence = TTAGCACTCGCAATGGTCGAGTGCTAA

Gene: CV4015: Heat shock protein 60 family co-chaperone GroES
 
Neisseria meningitidis MC58

Gene: NMB1973: Heat shock protein 60 family co-chaperone GroES
*2
Laribacter hongkongensis HLHK9

Site:
position = -97
score = 7.01636
sequence = TTAGCACTCGTGAAGCGGGAGTGCTAA

Gene: LHK_01878: Heat shock protein 60 family co-chaperone GroES

Site:
position = -97
score = 6.91987
sequence = TTGGCACTCGTGAGTGATGAGTGCTAA

Gene: LHK_00659: Heat shock protein 60 family co-chaperone GroES
*
Methylobacillus flagellatus KT

Site:
position = -97
score = 7.27868
sequence = TTAGCACTCGATAGGGTTGAGTGCTAA

Gene: Mfla_0365: Heat shock protein 60 family co-chaperone GroES
*
Methylotenera mobilis JLW8

Site:
position = -94
score = 6.9486
sequence = TTAGCAATCGAGGTGCGCGAGTGCTAA

Gene: Mmol_0429: Heat shock protein 60 family co-chaperone GroES
*
Methylophilales bacterium HTCC2181

Site:
position = -91
score = 6.97407
sequence = TTAGCACTCTATCAAGTTGAGTGCTAA

Gene: MB2181_06400: Heat shock protein 60 family co-chaperone GroES
Heat shock protein 60 family co-chaperone GroES
groL
 
Azoarcus sp. EbN1

Gene: ebA1185: Heat shock protein 60 family chaperone GroEL
 
Thauera sp. MZ1T

Gene: Tmz1t_1420: Heat shock protein 60 family chaperone GroEL
 
Dechloromonas aromatica RCB

Gene: Daro_0426: Heat shock protein 60 family chaperone GroEL
 
Nitrosomonas europaea ATCC 19718

Gene: NE0028: Heat shock protein 60 family chaperone GroEL
 
Nitrosospira multiformis ATCC 25196

Gene: Nmul_A2344: Heat shock protein 60 family chaperone GroEL
 
Thiobacillus denitrificans

Gene: Tbd_0091: Heat shock protein 60 family chaperone GroEL
 
Chromobacterium violaceum ATCC 12472

Gene: CV4014: Heat shock protein 60 family chaperone GroEL
 
Neisseria meningitidis MC58

Gene: NMB1972: Heat shock protein 60 family chaperone GroEL
 2
Laribacter hongkongensis HLHK9

Gene: LHK_01877: Heat shock protein 60 family chaperone GroEL

Gene: LHK_00660: Heat shock protein 60 family chaperone GroEL
 
Methylobacillus flagellatus KT

Gene: Mfla_0364: Heat shock protein 60 family chaperone GroEL
 
Methylotenera mobilis JLW8

Gene: Mmol_0428: Heat shock protein 60 family chaperone GroEL
 
Methylophilales bacterium HTCC2181

Gene: MB2181_06405: Heat shock protein 60 family chaperone GroEL
Heat shock protein 60 family chaperone GroEL
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD