Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog HrcA - Comamonadaceae

Properties
Regulator type: Transcription factor
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Phylum: Proteobacteria/beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 22 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Acidovorax avenae subsp. citrulli AAC00-1 3 2
Acidovorax sp. JS42 3 2
Comamonas testosteroni KF-1 3 2
Delftia acidovorans SPH-1 3 2
Polaromonas naphthalenivorans CJ2 3 2
Polaromonas sp. JS666 3 2
Rhodoferax ferrireducens DSM 15236 3 2
Variovorax paradoxus S110 3 2
Verminephrobacter eiseniae EF01-2 3 2
Methylibium petroleiphilum PM1 3 2
Leptothrix cholodnii SP-6 3 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
rpoH
*
Acidovorax avenae subsp. citrulli AAC00-1

Site:
position = -57
score = 6.54908
sequence = TTAGCACTCCCTCCAAGAGACTGCTAA

Gene: Aave_3894: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
*
Acidovorax sp. JS42

Site:
position = -28
score = 6.97499
sequence = TTAGCACTCTCTCCAATGGAGTGCTAA

Gene: Ajs_3522: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
*
Comamonas testosteroni KF-1

Site:
position = -28
score = 6.83008
sequence = TTAGCACTCTCTCTAACGGAGTGCTAA

Gene: CtesDRAFT_2864: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
*
Delftia acidovorans SPH-1

Site:
position = -57
score = 6.99195
sequence = TTAGCACTCGGTCATAACGAGTGCTAA

Gene: Daci_1694: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
*
Polaromonas naphthalenivorans CJ2

Site:
position = -57
score = 6.00645
sequence = CTGGCACTCTCTCTGATGGAGTGCTAA

Gene: Pnap_0889: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
*
Polaromonas sp. JS666

Site:
position = -57
score = 6.97499
sequence = TTAGCACTCTCTCCAATGGAGTGCTAA

Gene: Bpro_1256: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
*
Rhodoferax ferrireducens DSM 15236

Site:
position = -58
score = 7.13299
sequence = TTAGCACTCTCTCTCATAGAGTGCTAA

Gene: Rfer_1692: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
*
Variovorax paradoxus S110

Site:
position = -55
score = 6.91404
sequence = TTAGCACTCCCTCCAATCGAGTGCTAA

Gene: Vapar_4379: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
*
Verminephrobacter eiseniae EF01-2

Site:
position = -72
score = 6.60359
sequence = TTGGCACTCGATCGCAGAGAGTGCTAA

Gene: Veis_4476: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
*
Methylibium petroleiphilum PM1

Site:
position = -54
score = 7.17409
sequence = TTAGCACTCGTTTTACGTGAGTGCTAA

Gene: Mpe_A3171: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
*
Leptothrix cholodnii SP-6

Site:
position = -59
score = 6.9416
sequence = TTAGCACTCTCGAGGGTCGAGTGCTAA

Gene: Lcho_3542: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
 
CRON 2.
groS
*
Acidovorax avenae subsp. citrulli AAC00-1

Site:
position = -123
score = 6.92309
sequence = TTAGCACTCGAAGCGGACGAGTGCTAA

Gene: Aave_0946: Heat shock protein 60 family co-chaperone GroES
*
Acidovorax sp. JS42

Site:
position = -112
score = 7.20358
sequence = TTAGCACTCGAAACAGATGAGTGCTAA

Gene: Ajs_0700: Heat shock protein 60 family co-chaperone GroES
*
Comamonas testosteroni KF-1

Site:
position = -111
score = 7.02817
sequence = TTAGCACTCAATGGGGTTGAGTGCTAA

Gene: CtesDRAFT_4575: Heat shock protein 60 family co-chaperone GroES
*
Delftia acidovorans SPH-1

Site:
position = -114
score = 6.95003
sequence = TTAGCACTCGTTGGGCATGAGTGCTAA

Gene: Daci_5660: Heat shock protein 60 family co-chaperone GroES
*
Polaromonas naphthalenivorans CJ2

Site:
position = -134
score = 6.83068
sequence = TTAGCACTCGATGAGGTGGAGTGCTAA

Gene: Pnap_0658: Heat shock protein 60 family co-chaperone GroES
*
Polaromonas sp. JS666

Site:
position = -121
score = 7.19711
sequence = TTAGCACTCGATGGTATTGAGTGCTAA

Gene: Bpro_0760: Heat shock protein 60 family co-chaperone GroES
*
Rhodoferax ferrireducens DSM 15236

Site:
position = -130
score = 7.20358
sequence = TTAGCACTCGTAAGAGTTGAGTGCTAA

Gene: Rfer_1132: Heat shock protein 60 family co-chaperone GroES
*
Variovorax paradoxus S110

Site:
position = -110
score = 7.021
sequence = TTAGCACTCGCTGCTGACGAGTGCTAA

Gene: Vapar_1119: Heat shock protein 60 family co-chaperone GroES
*
Verminephrobacter eiseniae EF01-2

Site:
position = -110
score = 6.78183
sequence = TTAGCACTCTCCGCTGGGGAGTGCTAA

Gene: Veis_2566: Heat shock protein 60 family co-chaperone GroES
*
Methylibium petroleiphilum PM1

Site:
position = -129
score = 6.26404
sequence = CTAGCACTCGCGCAGACTGAGTGCTAA

Gene: Mpe_A0427: Heat shock protein 60 family co-chaperone GroES
*
Leptothrix cholodnii SP-6

Site:
position = -96
score = 6.46445
sequence = TTAGCACTCGCCGGTGGTGAGTGCTAG

Gene: Lcho_0482: Heat shock protein 60 family co-chaperone GroES
Heat shock protein 60 family co-chaperone GroES
groL
 
Acidovorax avenae subsp. citrulli AAC00-1

Gene: Aave_0945: Heat shock protein 60 family chaperone GroEL
 
Acidovorax sp. JS42

Gene: Ajs_0699: Heat shock protein 60 family chaperone GroEL
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_4574: Heat shock protein 60 family chaperone GroEL
 
Delftia acidovorans SPH-1

Gene: Daci_5661: Heat shock protein 60 family chaperone GroEL
 
Polaromonas naphthalenivorans CJ2

Gene: Pnap_0657: Heat shock protein 60 family chaperone GroEL
 
Polaromonas sp. JS666

Gene: Bpro_0759: Heat shock protein 60 family chaperone GroEL
 
Rhodoferax ferrireducens DSM 15236

Gene: Rfer_1131: Heat shock protein 60 family chaperone GroEL
 
Variovorax paradoxus S110

Gene: Vapar_1118: Heat shock protein 60 family chaperone GroEL
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_2567: Heat shock protein 60 family chaperone GroEL
 
Methylibium petroleiphilum PM1

Gene: Mpe_A0428: Heat shock protein 60 family chaperone GroEL
 
Leptothrix cholodnii SP-6

Gene: Lcho_0483: Heat shock protein 60 family chaperone GroEL
Heat shock protein 60 family chaperone GroEL
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD