Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog HrcA - Burkholderia

Properties
Regulator type: Transcription factor
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Phylum: Proteobacteria/beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 16 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Burkholderia pseudomallei K96243 3 2
Burkholderia mallei ATCC 23344 3 2
Burkholderia sp. 383 3 2
Burkholderia cepacia AMMD 3 2
Burkholderia vietnamiensis G4 3 2
Burkholderia glumae BGR1 3 2
Burkholderia xenovorans LB400 3 2
Burkholderia phymatum STM815 3 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
groS
*
Burkholderia pseudomallei K96243

Site:
position = -103
score = 7.92574
sequence = TTAGCACTCGCTGCACGAGAGTGCTAA

Gene: BPSL2698: Heat shock protein 60 family co-chaperone GroES
*
Burkholderia mallei ATCC 23344

Site:
position = -103
score = 7.92574
sequence = TTAGCACTCGCTGCACGAGAGTGCTAA

Gene: BMA2002: Heat shock protein 60 family co-chaperone GroES
*
Burkholderia sp. 383

Site:
position = -100
score = 7.92574
sequence = TTAGCACTCGCTGCACGAGAGTGCTAA

Gene: Bcep18194_A3954: Heat shock protein 60 family co-chaperone GroES
*
Burkholderia cepacia AMMD

Site:
position = -100
score = 7.92574
sequence = TTAGCACTCGCTGCACGAGAGTGCTAA

Gene: Bamb_0732: Heat shock protein 60 family co-chaperone GroES
*
Burkholderia vietnamiensis G4

Site:
position = -100
score = 7.92574
sequence = TTAGCACTCGCTGCACGAGAGTGCTAA

Gene: Bcep1808_0793: Heat shock protein 60 family co-chaperone GroES
*
Burkholderia glumae BGR1

Site:
position = -98
score = 7.92574
sequence = TTAGCACTCGCTGCACGAGAGTGCTAA

Gene: bglu_1g07140: Heat shock protein 60 family co-chaperone GroES
*
Burkholderia xenovorans LB400

Site:
position = -99
score = 7.92574
sequence = TTAGCACTCGCTGCACGAGAGTGCTAA

Gene: Bxe_A3816: Heat shock protein 60 family co-chaperone GroES
*
Burkholderia phymatum STM815

Site:
position = -100
score = 7.55871
sequence = TTAGCACTCACCGCACGAGAGTGCTAA

Gene: Bphy_2334: Heat shock protein 60 family co-chaperone GroES
Heat shock protein 60 family co-chaperone GroES
groL
 
Burkholderia pseudomallei K96243

Gene: BPSL2697: Heat shock protein 60 family chaperone GroEL
 
Burkholderia mallei ATCC 23344

Gene: BMA2001: Heat shock protein 60 family chaperone GroEL
 
Burkholderia sp. 383

Gene: Bcep18194_A3955: Heat shock protein 60 family chaperone GroEL
 
Burkholderia cepacia AMMD

Gene: Bamb_0733: Heat shock protein 60 family chaperone GroEL
 
Burkholderia vietnamiensis G4

Gene: Bcep1808_0794: Heat shock protein 60 family chaperone GroEL
 
Burkholderia glumae BGR1

Gene: bglu_1g07150: Heat shock protein 60 family chaperone GroEL
 
Burkholderia xenovorans LB400

Gene: Bxe_A3815: Heat shock protein 60 family chaperone GroEL
 
Burkholderia phymatum STM815

Gene: Bphy_2333: Heat shock protein 60 family chaperone GroEL
Heat shock protein 60 family chaperone GroEL
 
CRON 2.
rpoH
*
Burkholderia pseudomallei K96243

Site:
position = -88
score = 7.16616
sequence = TTAGCACTCCAGTAGACGGAGTGCTAA

Gene: BPSL0504: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
*
Burkholderia mallei ATCC 23344

Site:
position = -88
score = 7.16616
sequence = TTAGCACTCCAGTAGACGGAGTGCTAA

Gene: BMA3138: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
*
Burkholderia sp. 383

Site:
position = -90
score = 7.22683
sequence = TTAGCACTCGTCTTGCGGGAGTGCTAA

Gene: Bcep18194_A6145: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
*
Burkholderia cepacia AMMD

Site:
position = -89
score = 7.51569
sequence = TTAGCACTCGGATTCCGGGAGTGCTAA

Gene: Bamb_2875: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
*
Burkholderia vietnamiensis G4

Site:
position = -28
score = 7.6004
sequence = TTAGCACTCGGATTACGGGAGTGCTAA

Gene: Bcep1808_2920: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
*
Burkholderia glumae BGR1

Site:
position = -85
score = 7.9093
sequence = TTAGCACTCTCCTGACGAGAGTGCTAA

Gene: bglu_1g31450: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
*
Burkholderia xenovorans LB400

Site:
position = -100
score = 7.00992
sequence = TTAGCACTCGGCAAATCAGAGTGCTAA

Gene: Bxe_A4146: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
*
Burkholderia phymatum STM815

Site:
position = -82
score = 7.3282
sequence = TTAGCACTCGGTAGATGAGAGTGCTAA

Gene: Bphy_0301: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD