Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog HrcA - Xanthomonadales

Properties
Regulator type: Transcription factor
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Xylella fastidiosa 9a5c 2 1
Xanthomonas axonopodis pv. citri str. 306 2 1
Xanthomonas campestris pv. campestris str. ATCC 33913 2 1
Stenotrophomonas maltophilia K279a 2 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
groS
*
Xylella fastidiosa 9a5c

Site:
position = -75
score = 6.85579
sequence = TTAGCACTCATTACATAAGAGTGCTAA

Gene: XF0616: Heat shock protein 60 family co-chaperone GroES
*
Xanthomonas axonopodis pv. citri str. 306

Site:
position = -75
score = 6.88223
sequence = CTGGCAGTCGTCATGTACGAGTGCTAA

Gene: XAC0541: Heat shock protein 60 family co-chaperone GroES
*
Xanthomonas campestris pv. campestris str. ATCC 33913

Site:
position = -77
score = 7.08568
sequence = CTGGCAGTCGTCACATACGAGTGCTAA

Gene: XCC0522: Heat shock protein 60 family co-chaperone GroES
*
Stenotrophomonas maltophilia K279a

Site:
position = -73
score = 6.77465
sequence = CTGGCACTCGCCTGGGGTGAGTGCTAA

Gene: Smlt4215: Heat shock protein 60 family co-chaperone GroES
Heat shock protein 60 family co-chaperone GroES
groL
 
Xylella fastidiosa 9a5c

Gene: XF0615: Heat shock protein 60 family chaperone GroEL
 
Xanthomonas axonopodis pv. citri str. 306

Gene: XAC0542: Heat shock protein 60 family chaperone GroEL
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC0523: Heat shock protein 60 family chaperone GroEL
 
Stenotrophomonas maltophilia K279a

Gene: Smlt4214: Heat shock protein 60 family chaperone GroEL
Heat shock protein 60 family chaperone GroEL
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD