Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog HrcA - Oceanospirillales/Alteromonadales

Properties
Regulator type: Transcription factor
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Hahella chejuensis KCTC 2396
Marinobacter aqueolei
Marinobacter sp. ELB17
Oceanobacter sp. RED65
Oceanospirillum sp. MED92
Marinomonas sp. MWYL1
Saccharophagus degradans 2-40
Teredinibacter turnerae T7901
Cellvibrio japonicus Ueda107
Chromohalobacter salexigens DSM 3043
Reinekea sp. MED297
Alcanivorax borkumensis SK2 3 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
groS
 
Hahella chejuensis KCTC 2396

Gene: HCH_04614: Heat shock protein 60 family co-chaperone GroES
 
Marinobacter aqueolei

Gene: Maqu_2031: Heat shock protein 60 family co-chaperone GroES
 
Marinobacter sp. ELB17

Gene: MELB17_18279: Heat shock protein 60 family co-chaperone GroES
 
Oceanobacter sp. RED65

Gene: RED65_03230: Heat shock protein 60 family co-chaperone GroES
 
Oceanospirillum sp. MED92

Gene: MED92_01781: Heat shock protein 60 family co-chaperone GroES
 
Marinomonas sp. MWYL1

Gene: Mmwyl1_2036: Heat shock protein 60 family co-chaperone GroES
 
Saccharophagus degradans 2-40

Gene: Sde_0883: Heat shock protein 60 family co-chaperone GroES
 
Teredinibacter turnerae T7901

Gene: TERTU_3023: Heat shock protein 60 family co-chaperone GroES
 
Cellvibrio japonicus Ueda107

Gene: CJA_2647: Heat shock protein 60 family co-chaperone GroES
 
Chromohalobacter salexigens DSM 3043

Gene: Csal_2159: Heat shock protein 60 family co-chaperone GroES
 
Reinekea sp. MED297

Gene: MED297_02687: Heat shock protein 60 family co-chaperone GroES
*
Alcanivorax borkumensis SK2

Site:
position = -96
score = 7.95677
sequence = TTAGCACTCCACTCATGAGAGTGCTAA

Gene: ABO_0633: Heat shock protein 60 family co-chaperone GroES
Heat shock protein 60 family co-chaperone GroES
groL
 
Hahella chejuensis KCTC 2396

Gene: HCH_04613: Heat shock protein 60 family chaperone GroEL
 
Marinobacter aqueolei

Gene: Maqu_2030: Heat shock protein 60 family chaperone GroEL
 
Marinobacter sp. ELB17

Gene: MELB17_18274: Heat shock protein 60 family chaperone GroEL
 
Oceanobacter sp. RED65

Gene: RED65_03235: Heat shock protein 60 family chaperone GroEL
 
Oceanospirillum sp. MED92

Gene: MED92_01786: Heat shock protein 60 family chaperone GroEL
 
Marinomonas sp. MWYL1

Gene: Mmwyl1_2037: Heat shock protein 60 family chaperone GroEL
 
Saccharophagus degradans 2-40

Gene: Sde_0884: Heat shock protein 60 family chaperone GroEL
 
Teredinibacter turnerae T7901

Gene: TERTU_3022: Heat shock protein 60 family chaperone GroEL
 
Cellvibrio japonicus Ueda107

Gene: CJA_2646: Heat shock protein 60 family chaperone GroEL
 
Chromohalobacter salexigens DSM 3043

Gene: Csal_2160: Heat shock protein 60 family chaperone GroEL
 
Reinekea sp. MED297

Gene: MED297_02692: Heat shock protein 60 family chaperone GroEL
 
Alcanivorax borkumensis SK2

Gene: ABO_0634: Heat shock protein 60 family chaperone GroEL
Heat shock protein 60 family chaperone GroEL
 
CRON 2.
rpoH
 
Hahella chejuensis KCTC 2396

Gene: HCH_00575: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
 
Marinobacter aqueolei

Gene: Maqu_3743: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
 
Marinobacter sp. ELB17

Gene: MELB17_01850: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
 
Oceanobacter sp. RED65

Gene: RED65_14952: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
 
Oceanospirillum sp. MED92

Gene: MED92_06573: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
 
Marinomonas sp. MWYL1

Gene: Mmwyl1_4325: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
 
Saccharophagus degradans 2-40

Gene: Sde_3594: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
 
Teredinibacter turnerae T7901

Gene: TERTU_0251: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
 
Cellvibrio japonicus Ueda107

Gene: CJA_3497: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
 
Chromohalobacter salexigens DSM 3043

Gene: Csal_2986: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
 
Reinekea sp. MED297

Gene: MED297_10611: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
*
Alcanivorax borkumensis SK2

Site:
position = -71
score = 8.12176
sequence = TTAGCACTCTATTAATTGGAGTGCTAA

Gene: ABO_2569: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD