Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog HrcA - Ralstonia

Properties
Regulator type: Transcription factor
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Phylum: Proteobacteria/beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 12 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Ralstonia solanacearum GMI1000 3 2
Ralstonia pickettii 12J 3 2
Ralstonia metallidurans CH34 3 2
Ralstonia eutropha JMP134 3 2
Ralstonia eutropha H16 3 2
Cupriavidus taiwanensis 3 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
groS
*
Ralstonia solanacearum GMI1000

Site:
position = -117
score = 7.17411
sequence = TTGGCACTCGCCTGGAGGGAGTGCTAA

Gene: RSc0641: Heat shock protein 60 family co-chaperone GroES
*
Ralstonia pickettii 12J

Site:
position = -118
score = 7.6448
sequence = TTAGCACTCGCCGGGCAGGAGTGCTAA

Gene: Rpic_0578: Heat shock protein 60 family co-chaperone GroES
*
Ralstonia metallidurans CH34

Site:
position = -118
score = 7.56588
sequence = TTAGCACTCGCTGGGGGAGAGTGCTAA

Gene: Rmet_0615: Heat shock protein 60 family co-chaperone GroES
*
Ralstonia eutropha JMP134

Site:
position = -130
score = 7.75413
sequence = TTAGCACTCGCTGGGGGTGAGTGCTAA

Gene: Reut_A2657: Heat shock protein 60 family co-chaperone GroES
*
Ralstonia eutropha H16

Site:
position = -121
score = 7.81697
sequence = TTAGCACTCGTCAGGGGTGAGTGCTAA

Gene: H16_A0705: Heat shock protein 60 family co-chaperone GroES
*
Cupriavidus taiwanensis

Site:
position = -121
score = 7.73851
sequence = TTAGCACTCGTCAGGGGGGAGTGCTAA

Gene: RALTA_A0685: Heat shock protein 60 family co-chaperone GroES
Heat shock protein 60 family co-chaperone GroES
groL
 
Ralstonia solanacearum GMI1000

Gene: RSc0642: Heat shock protein 60 family chaperone GroEL
 
Ralstonia pickettii 12J

Gene: Rpic_0579: Heat shock protein 60 family chaperone GroEL
 
Ralstonia metallidurans CH34

Gene: Rmet_0616: Heat shock protein 60 family chaperone GroEL
 
Ralstonia eutropha JMP134

Gene: Reut_A2656: Heat shock protein 60 family chaperone GroEL
 
Ralstonia eutropha H16

Gene: H16_A0706: Heat shock protein 60 family chaperone GroEL
 
Cupriavidus taiwanensis

Gene: RALTA_A0686: Heat shock protein 60 family chaperone GroEL
Heat shock protein 60 family chaperone GroEL
 
CRON 2.
rpoH
*
Ralstonia solanacearum GMI1000

Site:
position = -70
score = 7.43468
sequence = TTAGCACTCATCCAGCCGGAGTGCTAA

Gene: RSc0374: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
*
Ralstonia pickettii 12J

Site:
position = -70
score = 7.60832
sequence = TTAGCACTCATCCGGTTGGAGTGCTAA

Gene: Rpic_0230: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
*
Ralstonia metallidurans CH34

Site:
position = -96
score = 7.65464
sequence = TTAGCACTCGTCCGGTTCGAGTGCTAA

Gene: Rmet_0272: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
*
Ralstonia eutropha JMP134

Site:
position = -104
score = 7.89102
sequence = TTAGCACTCACCCGGCTTGAGTGCTAA

Gene: Reut_A0325: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
*
Ralstonia eutropha H16

Site:
position = -104
score = 7.89102
sequence = TTAGCACTCACCCGGCCTGAGTGCTAA

Gene: H16_A0354: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
*
Cupriavidus taiwanensis

Site:
position = -108
score = 7.70278
sequence = TTAGCACTCACCCGGCCAGAGTGCTAA

Gene: RALTA_A0299: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD