Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ThuR - Rhizobiales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Trehalose utilization
Effector: Trehalose
Phylum: Proteobacteria/Alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 18 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Agrobacterium tumefaciens str. C58 (Cereon) 7 2
Sinorhizobium meliloti 1021 7 2
Rhizobium sp. NGR234 7 2
Rhizobium etli CFN 42 9 3
Rhizobium leguminosarum bv. viciae 3841
Azorhizobium caulinodans ORS 571
Mesorhizobium loti MAFF303099
Mesorhizobium sp. BNC1
Brucella melitensis 16M 9 2
Bartonella quintana str. Toulouse
Rhodopseudomonas palustris CGA009
Nitrobacter winogradskyi Nb-255
Bradyrhizobium japonicum USDA 110
Bradyrhizobium sp. BTAi1
Xanthobacter autotrophicus Py2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
thuE
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -210
score = 6.58951
sequence = AATTGAAAACGATTTCAATT

Site:
position = -58
score = 5.00467
sequence = AGTCAAAAGCGCTTTCAATT

Gene: Atu3338: Putative trehalose ABC transporter, substrate-binding protein
*
Sinorhizobium meliloti 1021

Site:
position = -258
score = 5.99126
sequence = GATCCAAATCGTTTTAAATT

Site:
position = -63
score = 4.89171
sequence = TACCCAAACCGTTTTCGAAT

Gene: SMb20325: Putative trehalose ABC transporter, substrate-binding protein
*
Rhizobium sp. NGR234

Site:
position = -252
score = 5.16714
sequence = TAGCCCAATCGTTTTAAATT

Site:
position = -68
score = 5.09886
sequence = CAGCCAAACCGTTTTCGAAT

Gene: NGR_b23140: Putative trehalose ABC transporter, substrate-binding protein
*
Rhizobium etli CFN 42

Site:
position = -194
score = 6.68579
sequence = AATTGAAATCGATTTCAATT

Site:
position = -34
score = 5.62053
sequence = TGTCCAAATCGATTTCAATT

Gene: RHE_PF00210: Putative trehalose ABC transporter, substrate-binding protein
 
Rhizobium leguminosarum bv. viciae 3841

Gene: pRL120035: Putative trehalose ABC transporter, substrate-binding protein
 
Azorhizobium caulinodans ORS 571
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
*
Brucella melitensis 16M

Site:
position = -244
score = 5.84854
sequence = AATCCAAACCGCTTTCAATC

Site:
position = -75
score = 5.24342
sequence = TACCCAAACCGTTTTCGATT

Gene: BMEII0945: Putative trehalose ABC transporter, substrate-binding protein
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Nitrobacter winogradskyi Nb-255
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Xanthobacter autotrophicus Py2
Putative trehalose ABC transporter, substrate-binding protein
thuF
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu3339: Putative trehalose ABC transporter, inner membrane protein
 
Sinorhizobium meliloti 1021

Gene: SMb20326: Putative trehalose ABC transporter, inner membrane protein
 
Rhizobium sp. NGR234

Gene: NGR_b23130: Putative trehalose ABC transporter, inner membrane protein
 
Rhizobium etli CFN 42

Gene: RHE_PF00209: Putative trehalose ABC transporter, inner membrane protein
 
Rhizobium leguminosarum bv. viciae 3841

Gene: pRL120036: Putative trehalose ABC transporter, inner membrane protein
 
Azorhizobium caulinodans ORS 571
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 2
Brucella melitensis 16M

Gene: BMEII0944: Putative trehalose ABC transporter, inner membrane protein

Gene: BMEII0943: Putative trehalose ABC transporter, inner membrane protein
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Nitrobacter winogradskyi Nb-255
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Xanthobacter autotrophicus Py2
Putative trehalose ABC transporter, inner membrane protein
thuG
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu3340: Putative trehalose ABC transporter, inner membrane protein
 
Sinorhizobium meliloti 1021

Gene: SMb20327: Putative trehalose ABC transporter, inner membrane protein
 
Rhizobium sp. NGR234

Gene: NGR_b23120: Putative trehalose ABC transporter, inner membrane protein
 
Rhizobium etli CFN 42

Gene: RHE_PF00208: Putative trehalose ABC transporter, inner membrane protein
 
Rhizobium leguminosarum bv. viciae 3841

Gene: pRL120037: Putative trehalose ABC transporter, inner membrane protein
 
Azorhizobium caulinodans ORS 571
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Brucella melitensis 16M

Gene: BMEII0942: Putative trehalose ABC transporter, inner membrane protein
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Nitrobacter winogradskyi Nb-255
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Xanthobacter autotrophicus Py2
Putative trehalose ABC transporter, inner membrane protein
thuK
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu3341: Putative trehalose ABC transporter, ATP-binding protein
 
Sinorhizobium meliloti 1021

Gene: SMb20328: Putative trehalose ABC transporter, ATP-binding protein
 
Rhizobium sp. NGR234

Gene: NGR_b23110: Putative trehalose ABC transporter, ATP-binding protein
 
Rhizobium etli CFN 42

Gene: RHE_PF00207: Putative trehalose ABC transporter, ATP-binding protein
 
Rhizobium leguminosarum bv. viciae 3841

Gene: pRL120038: Putative trehalose ABC transporter, ATP-binding protein
 
Azorhizobium caulinodans ORS 571
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 2
Brucella melitensis 16M

Gene: BMEII0941: Putative trehalose ABC transporter, ATP-binding protein

Gene: BMEII0940: Putative trehalose ABC transporter, ATP-binding protein
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Nitrobacter winogradskyi Nb-255
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Xanthobacter autotrophicus Py2
Putative trehalose ABC transporter, ATP-binding protein
thuA
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu3342: Trehalose utilization protein ThuA
 
Sinorhizobium meliloti 1021

Gene: SMb20329: Trehalose utilization protein ThuA
 
Rhizobium sp. NGR234

Gene: NGR_b23100: Trehalose utilization protein ThuA
 
Rhizobium etli CFN 42

Gene: RHE_PF00206: Trehalose utilization protein ThuA
 
Rhizobium leguminosarum bv. viciae 3841

Gene: pRL120039: Trehalose utilization protein ThuA
 
Azorhizobium caulinodans ORS 571
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Brucella melitensis 16M

Gene: BMEII0939: Trehalose utilization protein ThuA
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Nitrobacter winogradskyi Nb-255
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Xanthobacter autotrophicus Py2
Trehalose utilization protein ThuA
thuB
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu3343: Trehalose utilization oxidoreductase protein ThuB
 
Sinorhizobium meliloti 1021

Gene: SMb20330: Trehalose utilization oxidoreductase protein ThuB
 
Rhizobium sp. NGR234

Gene: NGR_b23090: Trehalose utilization oxidoreductase protein ThuB
 
Rhizobium etli CFN 42

Gene: RHE_PF00205: Trehalose utilization oxidoreductase protein ThuB
 
Rhizobium leguminosarum bv. viciae 3841

Gene: pRL120040: Trehalose utilization oxidoreductase protein ThuB
 
Azorhizobium caulinodans ORS 571
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Brucella melitensis 16M

Gene: BMEII0938: Trehalose utilization oxidoreductase protein ThuB
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Nitrobacter winogradskyi Nb-255
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Xanthobacter autotrophicus Py2
Trehalose utilization oxidoreductase protein ThuB
 
CRON 2.
thuR
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -78
score = 6.58951
sequence = AATTGAAATCGTTTTCAATT

Site:
position = -230
score = 5.00467
sequence = AATTGAAAGCGCTTTTGACT

Gene: Atu3337: Putative trehalose utilization regulator ThuR, LacI family
*
Sinorhizobium meliloti 1021

Site:
position = -240
score = 5.99126
sequence = AATTTAAAACGATTTGGATC

Gene: SMb20324: Putative trehalose utilization regulator ThuR, LacI family
*
Rhizobium sp. NGR234

Site:
position = -141
score = 5.16714
sequence = AATTTAAAACGATTGGGCTA

Gene: NGR_b23150: Putative trehalose utilization regulator ThuR, LacI family
*
Rhizobium etli CFN 42

Site:
position = -257
score = 5.62053
sequence = AATTGAAATCGATTTGGACA

Site:
position = -97
score = 6.68579
sequence = AATTGAAATCGATTTCAATT

Gene: RHE_PF00211: Putative trehalose utilization regulator ThuR, LacI family
 
Rhizobium leguminosarum bv. viciae 3841
 
Azorhizobium caulinodans ORS 571
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
*
Brucella melitensis 16M

Site:
position = -126
score = 5.84854
sequence = GATTGAAAGCGGTTTGGATT

Gene: BMEII0946: Putative trehalose utilization regulator ThuR, LacI family
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Nitrobacter winogradskyi Nb-255
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Xanthobacter autotrophicus Py2
Putative trehalose utilization regulator ThuR, LacI family
 
CRON 3.
thuA2
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
*
Rhizobium etli CFN 42

Site:
position = -67
score = 5.6844
sequence = TTTCCAAAGCGCTTTGAATT

Gene: RHE_CH03256: Trehalose utilization protein ThuA
 
Rhizobium leguminosarum bv. viciae 3841
 
Azorhizobium caulinodans ORS 571
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Nitrobacter winogradskyi Nb-255
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Xanthobacter autotrophicus Py2
Trehalose utilization protein ThuA
thuB2
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium etli CFN 42

Gene: RHE_CH03255: Trehalose utilization oxidoreductase protein ThuB
 
Rhizobium leguminosarum bv. viciae 3841
 
Azorhizobium caulinodans ORS 571
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Nitrobacter winogradskyi Nb-255
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Xanthobacter autotrophicus Py2
Trehalose utilization oxidoreductase protein ThuB
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD