Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog AglR - Rhodobacterales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Alpha-glucosides utilization
Effector: Alpha-glucoside; Maltose; Sucrose; Trehalose
Phylum: Proteobacteria/Alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 14 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Rhodobacter sphaeroides 2.4.1
Paracoccus denitrificans PD1222
Jannaschia sp. CCS1 8 2
Rhodobacterales bacterium HTCC2654 8 2
Oceanicola granulosus HTCC2516 7 2
Oceanicola batsensis HTCC2597
Loktanella vestfoldensis SKA53 8 2
Roseovarius nubinhibens ISM
Roseovarius sp. 217
Sulfitobacter sp. EE-36
Silicibacter TM1040 7 2
Silicibacter pomeroyi DSS-3
Roseobacter sp. MED193
Hyphomonas neptunium ATCC 15444
Oceanicaulis alexandrii HTCC2633
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
aglE
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_2873: Alpha-glucoside ABC transporter periplasmic sugar-binding protein
 
Paracoccus denitrificans PD1222
*
Jannaschia sp. CCS1

Site:
position = -104
score = 4.90517
sequence = ACCCCAAAGCGCTTTGAAAA

Gene: Jann_1946: Alpha-glucoside ABC transporter periplasmic sugar-binding protein
*
Rhodobacterales bacterium HTCC2654

Site:
position = -97
score = 5.61932
sequence = CATCCAAAACGGTTTGGAGC

Gene: RB2654_03739: Alpha-glucoside ABC transporter periplasmic sugar-binding protein
*
Oceanicola granulosus HTCC2516

Site:
position = -96
score = 6.06337
sequence = CGTCCAAAGCGCTTTGATCC

Gene: OG2516_02419: Alpha-glucoside ABC transporter periplasmic sugar-binding protein
 
Oceanicola batsensis HTCC2597
*
Loktanella vestfoldensis SKA53

Site:
position = -112
score = 6.20408
sequence = CATCCAAAGCGCTTTGGTAC

Gene: SKA53_03279: Alpha-glucoside ABC transporter periplasmic sugar-binding protein
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
*
Silicibacter TM1040

Site:
position = -257
score = 5.08268
sequence = CCTCCAAAGCGCTTTAAAAA

Site:
position = -102
score = 6.3448
sequence = CAATCAAAGCGCTTTGAATC

Gene: TM1040_3307: Alpha-glucoside ABC transporter periplasmic sugar-binding protein
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Alpha-glucoside ABC transporter periplasmic sugar-binding protein
aglF
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_2872: Alpha-glucoside ABC transporter permease protein
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1

Gene: Jann_1947: Alpha-glucoside ABC transporter permease protein
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_03734: Alpha-glucoside ABC transporter permease protein
 
Oceanicola granulosus HTCC2516

Gene: OG2516_02424: Alpha-glucoside ABC transporter permease protein
 
Oceanicola batsensis HTCC2597
 
Loktanella vestfoldensis SKA53

Gene: SKA53_03284: Alpha-glucoside ABC transporter permease protein
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040

Gene: TM1040_3306: Alpha-glucoside ABC transporter permease protein
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Alpha-glucoside ABC transporter permease protein
aglG
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_2871: Alpha-glucoside ABC transporter permease protein
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1

Gene: Jann_1948: Alpha-glucoside ABC transporter permease protein
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_03729: Alpha-glucoside ABC transporter permease protein
 
Oceanicola granulosus HTCC2516

Gene: OG2516_02429: Alpha-glucoside ABC transporter permease protein
 
Oceanicola batsensis HTCC2597
 
Loktanella vestfoldensis SKA53

Gene: SKA53_03289: Alpha-glucoside ABC transporter permease protein
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040

Gene: TM1040_3305: Alpha-glucoside ABC transporter permease protein
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Alpha-glucoside ABC transporter permease protein
aglA
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1

Gene: Jann_1949: Alpha-glucosidase AglA
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_03724: Alpha-glucosidase AglA
 
Oceanicola granulosus HTCC2516

Gene: OG2516_02434: Alpha-glucosidase AglA
 
Oceanicola batsensis HTCC2597
 
Loktanella vestfoldensis SKA53

Gene: SKA53_03294: Alpha-glucosidase AglA
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040

Gene: TM1040_3304: Alpha-glucosidase AglA
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Alpha-glucosidase AglA
aglK
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_2870: Alpha-glucoside ABC transporter ATP-binding protein
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1

Gene: Jann_1950: Alpha-glucoside ABC transporter ATP-binding protein
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_03719: Alpha-glucoside ABC transporter ATP-binding protein
 
Oceanicola granulosus HTCC2516

Gene: OG2516_02439: Alpha-glucoside ABC transporter ATP-binding protein
 
Oceanicola batsensis HTCC2597
 
Loktanella vestfoldensis SKA53

Gene: SKA53_03299: Alpha-glucoside ABC transporter ATP-binding protein
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040

Gene: TM1040_3303: Alpha-glucoside ABC transporter ATP-binding protein
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Alpha-glucoside ABC transporter ATP-binding protein
 
CRON 2.
aglR
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
*
Jannaschia sp. CCS1

Site:
position = -31
score = 5.80656
sequence = AATTCCAAGCGCTTTGAAAG

Site:
position = -204
score = 4.90517
sequence = TTTTCAAAGCGCTTTGGGGT

Gene: Jann_1945: Transcriptional regulator of alpha-glucoside utilization, LacI family
*
Rhodobacterales bacterium HTCC2654

Site:
position = -170
score = 5.61932
sequence = GCTCCAAACCGTTTTGGATG

Gene: RB2654_03744: Transcriptional regulator of alpha-glucoside utilization, LacI family
*
Oceanicola granulosus HTCC2516

Site:
position = -194
score = 6.06337
sequence = GGATCAAAGCGCTTTGGACG

Site:
position = -28
score = 5.12366
sequence = CTCCTAAAGCGCTTTGGAAG

Gene: OG2516_02414: Transcriptional regulator of alpha-glucoside utilization, LacI family
 
Oceanicola batsensis HTCC2597
*
Loktanella vestfoldensis SKA53

Site:
position = -121
score = 6.20408
sequence = GTACCAAAGCGCTTTGGATG

Gene: SKA53_03274: Transcriptional regulator of alpha-glucoside utilization, LacI family
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
*
Silicibacter TM1040

Site:
position = -29
score = 5.08268
sequence = TTTTTAAAGCGCTTTGGAGG

Site:
position = -184
score = 6.3448
sequence = GATTCAAAGCGCTTTGATTG

Gene: TM1040_3308: Transcriptional regulator of alpha-glucoside utilization, LacI family
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Transcriptional regulator of alpha-glucoside utilization, LacI family
RSP_2874
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1

Gene: Jann_1944: Beta-glucosidase (EC 3.2.1.21)
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_03749: Beta-glucosidase (EC 3.2.1.21)
 
Oceanicola granulosus HTCC2516
 
Oceanicola batsensis HTCC2597
 
Loktanella vestfoldensis SKA53

Gene: SKA53_03269: Beta-glucosidase (EC 3.2.1.21)
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040

Gene: TM1040_3309: Beta-glucosidase (EC 3.2.1.21)
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Beta-glucosidase (EC 3.2.1.21)
glk
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1

Gene: Jann_1943: Glucokinase (EC 2.7.1.2)
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_03754: Glucokinase (EC 2.7.1.2)
 
Oceanicola granulosus HTCC2516

Gene: OG2516_02409: Glucokinase (EC 2.7.1.2)
 
Oceanicola batsensis HTCC2597
 
Loktanella vestfoldensis SKA53

Gene: SKA53_03264: Glucokinase (EC 2.7.1.2)
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Glucokinase (EC 2.7.1.2)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD