Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog AglR - Rhizobiales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Alpha-glucosides utilization
Effector: Alpha-glucoside; Maltose; Trehalose; Sucrose
Phylum: Proteobacteria/Alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 24 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Agrobacterium tumefaciens str. C58 (Cereon) 6 2
Rhizobium etli CFN 42 6 2
Rhizobium leguminosarum bv. viciae 3841 8 3
Sinorhizobium meliloti 1021 6 2
Mesorhizobium loti MAFF303099 6 2
Bradyrhizobium japonicum USDA 110
Bradyrhizobium sp. BTAi1
Nitrobacter winogradskyi Nb-255
Mesorhizobium sp. BNC1 5 2
Rhizobium sp. NGR234 6 2
Bartonella quintana str. Toulouse
Brucella melitensis 16M
Azorhizobium caulinodans ORS 571
Xanthobacter autotrophicus Py2
Rhodopseudomonas palustris CGA009
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
aglE
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -221
score = 5.50016
sequence = TTCCCAAAGCGCTTTAGATT

Site:
position = -64
score = 6.07398
sequence = TAGCCAAAGCGCTTTGATTG

Gene: Atu0591: Alpha-glucoside ABC transporter periplasmic sugar-binding protein
*
Rhizobium etli CFN 42

Site:
position = -236
score = 5.74227
sequence = CGCTCAAAGCGCTTTTAATT

Site:
position = -73
score = 6.41074
sequence = GTGTCAAAGCGCTTTGAAAT

Gene: RHE_CH00696: Alpha-glucoside ABC transporter periplasmic sugar-binding protein
*
Rhizobium leguminosarum bv. viciae 3841

Site:
position = -245
score = 5.86075
sequence = CATCCAAAGCGCTTTCAATT

Site:
position = -73
score = 6.25159
sequence = GGGTCAAAGCGCTTTGAAAT

Gene: RL0745: Alpha-glucoside ABC transporter periplasmic sugar-binding protein
*
Sinorhizobium meliloti 1021

Site:
position = -104
score = 6.56409
sequence = AACTCAAAGCGCTTTGAATG

Gene: SMc03061: Alpha-glucoside ABC transporter periplasmic sugar-binding protein
*
Mesorhizobium loti MAFF303099

Site:
position = -138
score = 6.16376
sequence = AAGCCAAAGCGCTTTGGAAG

Gene: mll5113: Alpha-glucoside ABC transporter periplasmic sugar-binding protein
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
*
Mesorhizobium sp. BNC1

Site:
position = -105
score = 6.16259
sequence = TTCTCAAAGCGCTTTGAGCT

Gene: Meso_2855: Alpha-glucoside ABC transporter periplasmic sugar-binding protein
*
Rhizobium sp. NGR234

Site:
position = -83
score = 6.53738
sequence = AACTCAAAGCGCTTTGAATA

Gene: NGR_c03100: Alpha-glucoside ABC transporter periplasmic sugar-binding protein
 
Bartonella quintana str. Toulouse
 
Brucella melitensis 16M
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
 
Rhodopseudomonas palustris CGA009
Alpha-glucoside ABC transporter periplasmic sugar-binding protein
aglF
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu0592: Alpha-glucoside ABC transporter permease protein
 
Rhizobium etli CFN 42

Gene: RHE_CH00697: Alpha-glucoside ABC transporter permease protein
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL0746: Alpha-glucoside ABC transporter permease protein
 
Sinorhizobium meliloti 1021

Gene: SMc03062: Alpha-glucoside ABC transporter permease protein
 
Mesorhizobium loti MAFF303099

Gene: mll5112: Alpha-glucoside ABC transporter permease protein
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Mesorhizobium sp. BNC1

Gene: Meso_2856: Alpha-glucoside ABC transporter permease protein
 
Rhizobium sp. NGR234

Gene: NGR_c03110: Alpha-glucoside ABC transporter permease protein
 
Bartonella quintana str. Toulouse
 
Brucella melitensis 16M
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
 
Rhodopseudomonas palustris CGA009
Alpha-glucoside ABC transporter permease protein
aglG
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu0593: Alpha-glucoside ABC transporter permease protein
 
Rhizobium etli CFN 42

Gene: RHE_CH00698: Alpha-glucoside ABC transporter permease protein
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL0747: Alpha-glucoside ABC transporter permease protein
 
Sinorhizobium meliloti 1021

Gene: SMc03063: Alpha-glucoside ABC transporter permease protein
 
Mesorhizobium loti MAFF303099

Gene: mll5110: Alpha-glucoside ABC transporter permease protein
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Mesorhizobium sp. BNC1

Gene: Meso_2857: Alpha-glucoside ABC transporter permease protein
 
Rhizobium sp. NGR234

Gene: NGR_c03120: Alpha-glucoside ABC transporter permease protein
 
Bartonella quintana str. Toulouse
 
Brucella melitensis 16M
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
 
Rhodopseudomonas palustris CGA009
Alpha-glucoside ABC transporter permease protein
aglA
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu0594: Alpha-glucosidase AglA
 
Rhizobium etli CFN 42

Gene: RHE_CH00699: Alpha-glucosidase AglA
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL0748: Alpha-glucosidase AglA
 
Sinorhizobium meliloti 1021

Gene: SMc03064: Alpha-glucosidase AglA
 
Mesorhizobium loti MAFF303099

Gene: mll5109: Alpha-glucosidase AglA
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Mesorhizobium sp. BNC1
 
Rhizobium sp. NGR234

Gene: NGR_c03130: Alpha-glucosidase AglA
 
Bartonella quintana str. Toulouse
 
Brucella melitensis 16M
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
 
Rhodopseudomonas palustris CGA009
Alpha-glucosidase AglA
aglK
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu0595: Alpha-glucoside transport ATP-binding protein AglK
 
Rhizobium etli CFN 42

Gene: RHE_CH00700: Alpha-glucoside transport ATP-binding protein AglK
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL0749: Alpha-glucoside transport ATP-binding protein AglK
 
Sinorhizobium meliloti 1021

Gene: SMc03065: Alpha-glucoside transport ATP-binding protein AglK
 
Mesorhizobium loti MAFF303099

Gene: mll5107: Alpha-glucoside transport ATP-binding protein AglK
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Mesorhizobium sp. BNC1

Gene: Meso_2858: Alpha-glucoside transport ATP-binding protein AglK
 
Rhizobium sp. NGR234

Gene: NGR_c03140: Alpha-glucoside transport ATP-binding protein AglK
 
Bartonella quintana str. Toulouse
 
Brucella melitensis 16M
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
 
Rhodopseudomonas palustris CGA009
Alpha-glucoside ABC transporter ATP-binding protein
 
CRON 2.
thuA
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Rhizobium etli CFN 42
*
Rhizobium leguminosarum bv. viciae 3841

Site:
position = -66
score = 6.20772
sequence = TTTCCAAAGCGCTTTGAATC

Gene: RL3686: Trehalose utilization protein
 
Sinorhizobium meliloti 1021
 
Mesorhizobium loti MAFF303099
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Mesorhizobium sp. BNC1
 
Rhizobium sp. NGR234
 
Bartonella quintana str. Toulouse
 
Brucella melitensis 16M
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
 
Rhodopseudomonas palustris CGA009
Trehalose utilization protein
RL3685
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL3685: Oxidoreductase (EC 1.1.1.-)
 
Sinorhizobium meliloti 1021
 
Mesorhizobium loti MAFF303099
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Mesorhizobium sp. BNC1
 
Rhizobium sp. NGR234
 
Bartonella quintana str. Toulouse
 
Brucella melitensis 16M
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
 
Rhodopseudomonas palustris CGA009
Oxidoreductase (EC 1.1.1.-)
 
CRON 3.
aglR
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -76
score = 5.50016
sequence = AATCTAAAGCGCTTTGGGAA

Site:
position = -233
score = 6.07398
sequence = CAATCAAAGCGCTTTGGCTA

Gene: Atu0590: Transcriptional regulator of alpha-glucoside utilization, LacI family
*
Rhizobium etli CFN 42

Site:
position = -244
score = 6.41074
sequence = ATTTCAAAGCGCTTTGACAC

Site:
position = -81
score = 5.74227
sequence = AATTAAAAGCGCTTTGAGCG

Gene: RHE_CH00695: Transcriptional regulator of alpha-glucoside utilization, LacI family
*
Rhizobium leguminosarum bv. viciae 3841

Site:
position = -256
score = 6.25159
sequence = ATTTCAAAGCGCTTTGACCC

Site:
position = -84
score = 5.86075
sequence = AATTGAAAGCGCTTTGGATG

Gene: RL0744: Transcriptional regulator of alpha-glucoside utilization, LacI family
*
Sinorhizobium meliloti 1021

Site:
position = -30
score = 6.26624
sequence = TATTCAAAGCGCTTTGGAAG

Site:
position = -233
score = 6.56409
sequence = CATTCAAAGCGCTTTGAGTT

Gene: SMc03060: Transcriptional regulator of alpha-glucoside utilization, LacI family
*
Mesorhizobium loti MAFF303099

Site:
position = -240
score = 6.16376
sequence = CTTCCAAAGCGCTTTGGCTT

Site:
position = -21
score = 5.4071
sequence = ATTTAAAAGCGCTTTGAGGG

Gene: mlr5115: Transcriptional regulator of alpha-glucoside utilization, LacI family
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
*
Mesorhizobium sp. BNC1

Site:
position = -127
score = 6.16259
sequence = AGCTCAAAGCGCTTTGAGAA

Gene: Meso_2854: Transcriptional regulator of alpha-glucoside utilization, LacI family
*
Rhizobium sp. NGR234

Site:
position = -30
score = 6.18867
sequence = TATCCAAAGCGCTTTGAGAG

Site:
position = -235
score = 6.53738
sequence = TATTCAAAGCGCTTTGAGTT

Gene: NGR_c03090: Transcriptional regulator of alpha-glucoside utilization, LacI family
 
Bartonella quintana str. Toulouse
 
Brucella melitensis 16M
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
 
Rhodopseudomonas palustris CGA009
Transcriptional regulator of alpha-glucoside utilization, LacI family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD