Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog DVU0309 - Desulfovibrionales

Properties
Regulator type: Transcription factor
Regulator family: LysR
Regulation mode:
Biological process:
Effector:
Phylum: Proteobacteria/delta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 14 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Desulfohalobium retbaense DSM 5692 2 2
Desulfomicrobium baculatum DSM 4028
Desulfovibrio desulfuricans G20 2 2
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
Desulfovibrio magneticus RS-1
Desulfovibrio piger ATCC 29098
Desulfovibrio salexigens DSM 2638 2 2
Desulfovibrio vulgaris Hildenborough 2 2
Desulfovibrio vulgaris str. Miyazaki F
Lawsonia intracellularis PHE/MN1-00
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
DVU0309
*
Desulfohalobium retbaense DSM 5692

Site:
position = -418
score = 5.34443
sequence = GCTATCAAAATTTCTGATAGG

Gene: Dret_0355: transcriptional regulator, LysR family
 
Desulfomicrobium baculatum DSM 4028
*
Desulfovibrio desulfuricans G20

Site:
position = -34
score = 5.70836
sequence = TCTATCTAATTTTGTGATAGA

Site:
position = -67
score = 4.38809
sequence = ACTATCACATTGAGTGAGGGT

Gene: Dde_0349: transcriptional regulator, LysR family
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1
 
Desulfovibrio piger ATCC 29098
*
Desulfovibrio salexigens DSM 2638

Site:
position = -63
score = 5.03099
sequence = TCAATCTTTTATTCAGTTTGG

Site:
position = -31
score = 5.19883
sequence = ACAATCTTAAAACAAGATAGG

Gene: Desal_3366: transcriptional regulator, LysR family
*
Desulfovibrio vulgaris Hildenborough

Site:
position = -61
score = 5.12407
sequence = TCTATCTGGAAGACGGATTGA

Site:
position = -28
score = 5.73734
sequence = TCTATCTGAAAAACAGATGGA

Gene: DVU0309: transcriptional regulator, LysR family
 
Desulfovibrio vulgaris str. Miyazaki F
 
Lawsonia intracellularis PHE/MN1-00
transcriptional regulator, LysR family
 
CRON 2.
Dret_0354
*
Desulfohalobium retbaense DSM 5692

Site:
position = -184
score = 5.34443
sequence = CCTATCAGAAATTTTGATAGC

Gene: Dret_0354: peptidase M24
 
Desulfomicrobium baculatum DSM 4028
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F
 
Lawsonia intracellularis PHE/MN1-00
peptidase M24
 
CRON 3.
COG4125
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028
*
Desulfovibrio desulfuricans G20

Site:
position = -213
score = 4.38809
sequence = ACCCTCACTCAATGTGATAGT

Site:
position = -246
score = 5.70836
sequence = TCTATCACAAAATTAGATAGA

Gene: Dde_0348: membrane protein, putative
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1
 
Desulfovibrio piger ATCC 29098
*2
Desulfovibrio salexigens DSM 2638

Site:
position = -52
score = 5.03099
sequence = CCAAACTGAATAAAAGATTGA

Site:
position = -84
score = 5.19883
sequence = CCTATCTTGTTTTAAGATTGT

Gene: Desal_3365: membrane protein, putative

Gene: Desal_0582: membrane protein, putative
*
Desulfovibrio vulgaris Hildenborough

Site:
position = -85
score = 5.73734
sequence = TCCATCTGTTTTTCAGATAGA

Site:
position = -52
score = 5.12407
sequence = TCAATCCGTCTTCCAGATAGA

Gene: DVU0308: membrane protein, putative
 
Desulfovibrio vulgaris str. Miyazaki F
 
Lawsonia intracellularis PHE/MN1-00
membrane protein, putative
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD