Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog NagR - Chloroflexia

Properties
Regulator type: Transcription factor
Regulator family: ROK
Regulation mode:
Biological process: N-acetylglucosamine utilization
Effector: N-acetylglucosamine
Phylum: Chloroflexi
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Chloroflexus aggregans DSM 9485
Chloroflexus sp. Y-400-fl 9 1
Herpetosiphon aurantiacus ATCC 23779 9 1
Roseiflexus castenholzii DSM 13941 2 1
Roseiflexus sp. RS-1 2 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
nagR
 
Chloroflexus aggregans DSM 9485
*
Chloroflexus sp. Y-400-fl

Site:
position = -39
score = 6.77627
sequence = TTGTTAGTTCATTGGACTATCTA

Gene: Chy400_1208: Predicted N-acetyl-glucosamine repressor, ROK family
*
Herpetosiphon aurantiacus ATCC 23779

Site:
position = -23
score = 4.30592
sequence = TAGTAAATTCATTGGAATAAGTT

Site:
position = -418
score = 4.89981
sequence = GTAATGGTTCATTGGGTTAACAA

Gene: Haur_1182: Predicted N-acetyl-glucosamine repressor, ROK family
*
Roseiflexus castenholzii DSM 13941

Site:
position = -132
score = 6.87794
sequence = TTGTCAGTTCAATGGACTAACAC

Gene: Rcas_0477: Predicted N-acetyl-glucosamine repressor, ROK family
*
Roseiflexus sp. RS-1

Site:
position = -126
score = 6.67461
sequence = TTGTCAGTTCACTGAACTAATGA

Gene: RoseRS_4247: Predicted N-acetyl-glucosamine repressor, ROK family
Predicted N-acetyl-glucosamine repressor, ROK family
age
 
Chloroflexus aggregans DSM 9485
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_1209: N-acylglucosamine 2-epimerase (EC 5.1.3.8)
 
Herpetosiphon aurantiacus ATCC 23779
 
Roseiflexus castenholzii DSM 13941

Gene: Rcas_3784: N-acylglucosamine 2-epimerase (EC 5.1.3.8)
 
Roseiflexus sp. RS-1

Gene: RoseRS_1977: N-acylglucosamine 2-epimerase (EC 5.1.3.8)
N-acylglucosamine 2-epimerase (EC 5.1.3.8)
Chy400_1210
 
Chloroflexus aggregans DSM 9485
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_1210: hypothetical protein
 
Herpetosiphon aurantiacus ATCC 23779
 
Roseiflexus castenholzii DSM 13941
 
Roseiflexus sp. RS-1
hypothetical protein
chiE
 
Chloroflexus aggregans DSM 9485
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_1211: Predicted chitobiose ABC transport system, sugar-binding protein (Thermotoga-like)
 
Herpetosiphon aurantiacus ATCC 23779
 
Roseiflexus castenholzii DSM 13941
 
Roseiflexus sp. RS-1
Predicted chitobiose ABC transport system, sugar-binding protein (Thermotoga-like)
chiF
 
Chloroflexus aggregans DSM 9485
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_1212: Predicted chitobiose ABC transport system, permease protein 1 (Thermotoga-like)
 
Herpetosiphon aurantiacus ATCC 23779
 
Roseiflexus castenholzii DSM 13941
 
Roseiflexus sp. RS-1
Predicted chitobiose ABC transport system, permease protein 1 (Thermotoga-like)
chiG
 
Chloroflexus aggregans DSM 9485
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_1213: Predicted chitobiose ABC transport system, permease protein 2 (Thermotoga-like)
 
Herpetosiphon aurantiacus ATCC 23779
 
Roseiflexus castenholzii DSM 13941
 
Roseiflexus sp. RS-1
Predicted chitobiose ABC transport system, permease protein 2 (Thermotoga-like)
Chy400_1214
 
Chloroflexus aggregans DSM 9485
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_1214: glycoside hydrolase family 38
 
Herpetosiphon aurantiacus ATCC 23779
 
Roseiflexus castenholzii DSM 13941
 
Roseiflexus sp. RS-1
glycoside hydrolase family 38
hex2
 
Chloroflexus aggregans DSM 9485
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_1215: Beta-hexosaminidase
 
Herpetosiphon aurantiacus ATCC 23779
 
Roseiflexus castenholzii DSM 13941
 
Roseiflexus sp. RS-1
Beta-hexosaminidase
nagB
 
Chloroflexus aggregans DSM 9485
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_1216: Glucosamine-6-phosphate deaminase [isomerizing], alternative (EC 3.5.99.6)
 
Herpetosiphon aurantiacus ATCC 23779

Gene: Haur_1174: Glucosamine-6-phosphate deaminase [isomerizing], alternative (EC 3.5.99.6)
 
Roseiflexus castenholzii DSM 13941

Gene: Rcas_3111: Glucosamine-6-phosphate deaminase [isomerizing], alternative (EC 3.5.99.6)
 
Roseiflexus sp. RS-1

Gene: RoseRS_2367: Glucosamine-6-phosphate deaminase [isomerizing], alternative (EC 3.5.99.6)
Glucosamine-6-phosphate deaminase [isomerizing], alternative (EC 3.5.99.6)
nagK
 
Chloroflexus aggregans DSM 9485
 
Chloroflexus sp. Y-400-fl
 
Herpetosiphon aurantiacus ATCC 23779

Gene: Haur_1181: Predicted N-acetyl-glucosamine kinase, ROK family (EC 2.7.1.59)
 
Roseiflexus castenholzii DSM 13941
 
Roseiflexus sp. RS-1
Predicted N-acetyl-glucosamine kinase, ROK family (EC 2.7.1.59)
chbA
 
Chloroflexus aggregans DSM 9485
 
Chloroflexus sp. Y-400-fl
 
Herpetosiphon aurantiacus ATCC 23779

Gene: Haur_1180: Predicted chitobiose ABC transporter, periplasmic component
 
Roseiflexus castenholzii DSM 13941
 
Roseiflexus sp. RS-1
Predicted chitobiose ABC transporter, periplasmic component
chbB
 
Chloroflexus aggregans DSM 9485
 
Chloroflexus sp. Y-400-fl
 
Herpetosiphon aurantiacus ATCC 23779

Gene: Haur_1179: Predicted chitobiose ABC transporter, permease component 1
 
Roseiflexus castenholzii DSM 13941
 
Roseiflexus sp. RS-1
Predicted chitobiose ABC transporter, permease component 1
chbC
 
Chloroflexus aggregans DSM 9485
 
Chloroflexus sp. Y-400-fl
 
Herpetosiphon aurantiacus ATCC 23779

Gene: Haur_1178: Predicted chitobiose ABC transporter, permease component 2
 
Roseiflexus castenholzii DSM 13941
 
Roseiflexus sp. RS-1
Predicted chitobiose ABC transporter, permease component 2
hex
 
Chloroflexus aggregans DSM 9485
 
Chloroflexus sp. Y-400-fl
 
Herpetosiphon aurantiacus ATCC 23779

Gene: Haur_1177: Beta-hexosaminidase (EC 3.2.1.52)
 
Roseiflexus castenholzii DSM 13941
 
Roseiflexus sp. RS-1
Beta-hexosaminidase (EC 3.2.1.52)
Haur_1176
 
Chloroflexus aggregans DSM 9485
 
Chloroflexus sp. Y-400-fl
 
Herpetosiphon aurantiacus ATCC 23779

Gene: Haur_1176: hypothetical protein
 
Roseiflexus castenholzii DSM 13941
 
Roseiflexus sp. RS-1
hypothetical protein
nagA
 
Chloroflexus aggregans DSM 9485
 
Chloroflexus sp. Y-400-fl
 
Herpetosiphon aurantiacus ATCC 23779

Gene: Haur_1175: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
 
Roseiflexus castenholzii DSM 13941
 
Roseiflexus sp. RS-1
N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
Rcas_0478
 
Chloroflexus aggregans DSM 9485
 
Chloroflexus sp. Y-400-fl
 
Herpetosiphon aurantiacus ATCC 23779
 
Roseiflexus castenholzii DSM 13941

Gene: Rcas_0478: Predicted N-acetylglucosamine ABC transporter, sugar-binding component
 
Roseiflexus sp. RS-1

Gene: RoseRS_4248: Predicted N-acetylglucosamine ABC transporter, sugar-binding component
Predicted N-acetylglucosamine ABC transporter, sugar-binding component
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD