Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Caur_1157 - Chloroflexia

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Beta-glucosides utilization
Effector: Beta-glucoside
Phylum: Chloroflexi
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Chloroflexus sp. Y-400-fl 7 1
Chloroflexus aggregans DSM 9485 7 1
Herpetosiphon aurantiacus ATCC 23779 10 3
Roseiflexus sp. RS-1
Roseiflexus castenholzii DSM 13941
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
bglA
 
Chloroflexus sp. Y-400-fl
 
Chloroflexus aggregans DSM 9485

Gene: Cagg_3435: Endoglucanase B precursor (EC 3.2.1.4) (Endo-1,4-beta-glucanase B) (Cellulase B)
*
Herpetosiphon aurantiacus ATCC 23779

Site:
position = -207
score = 5.69641
sequence = GCTTGGGAGCGATCTCATTC

Site:
position = -131
score = 6.03787
sequence = CATTGGGAGCGGTCTCAATG

Gene: Haur_0296: Endoglucanase B precursor (EC 3.2.1.4) (Endo-1,4-beta-glucanase B) (Cellulase B)
 
Roseiflexus sp. RS-1
 
Roseiflexus castenholzii DSM 13941
Endoglucanase B precursor (EC 3.2.1.4) (Endo-1,4-beta-glucanase B) (Cellulase B)
Haur_0295
 
Chloroflexus sp. Y-400-fl
 
Chloroflexus aggregans DSM 9485
 
Herpetosiphon aurantiacus ATCC 23779

Gene: Haur_0295: Endoglucanase A precursor (EC 3.2.1.4) (Endo-1,4-beta-glucanase A) (Cellulase A)
 
Roseiflexus sp. RS-1
 
Roseiflexus castenholzii DSM 13941
Endoglucanase A precursor (EC 3.2.1.4) (Endo-1,4-beta-glucanase A) (Cellulase A)
Haur_0293
 
Chloroflexus sp. Y-400-fl
 
Chloroflexus aggregans DSM 9485
 2
Herpetosiphon aurantiacus ATCC 23779

Gene: Haur_0293: Endoglucanase 2 precursor (EC 3.2.1.4) (Endo-1,4-beta-glucanase 2) (Cellulase 2)

Gene: Haur_0294: Endoglucanase 2 precursor (EC 3.2.1.4) (Endo-1,4-beta-glucanase 2) (Cellulase 2)
 
Roseiflexus sp. RS-1
 
Roseiflexus castenholzii DSM 13941
Endoglucanase 2 precursor (EC 3.2.1.4) (Endo-1,4-beta-glucanase 2) (Cellulase 2)
 
CRON 2.
Haur_1418
 
Chloroflexus sp. Y-400-fl
 
Chloroflexus aggregans DSM 9485
*
Herpetosiphon aurantiacus ATCC 23779

Site:
position = -41
score = 5.21538
sequence = TATTGAGACCGATTCCAATG

Gene: Haur_1418: Cellulose 1,4-beta-cellobiosidase precursor (EC 3.2.1.91)
 
Roseiflexus sp. RS-1
 
Roseiflexus castenholzii DSM 13941
Cellulose 1,4-beta-cellobiosidase precursor (EC 3.2.1.91)
 
CRON 3.
Caur_1157
*
Chloroflexus sp. Y-400-fl

Site:
position = -117
score = 5.57077
sequence = GACTGGAAGCGCTTTCACGG

Gene: Chy400_1181: Predicted transcriptional regulator for beta-glucoside utilization, LacI family
*
Chloroflexus aggregans DSM 9485

Site:
position = -119
score = 5.57077
sequence = CCCTGGAAGCGCTTTCACGG

Gene: Cagg_1685: Predicted transcriptional regulator for beta-glucoside utilization, LacI family
*
Herpetosiphon aurantiacus ATCC 23779

Site:
position = -347
score = 6.03787
sequence = CATTGAGACCGCTCCCAATG

Site:
position = -271
score = 5.69641
sequence = GAATGAGATCGCTCCCAAGC

Gene: Haur_0297: Predicted transcriptional regulator for beta-glucoside utilization, LacI family
 
Roseiflexus sp. RS-1
 
Roseiflexus castenholzii DSM 13941
Predicted transcriptional regulator for beta-glucoside utilization, LacI family
Chy400_1180
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_1180: extracellular solute-binding protein family 1
 
Chloroflexus aggregans DSM 9485

Gene: Cagg_1686: extracellular solute-binding protein family 1
 
Herpetosiphon aurantiacus ATCC 23779
 
Roseiflexus sp. RS-1
 
Roseiflexus castenholzii DSM 13941
extracellular solute-binding protein family 1
Chy400_1179
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_1179: binding-protein-dependent transport systems inner membrane component
 
Chloroflexus aggregans DSM 9485

Gene: Cagg_1687: binding-protein-dependent transport systems inner membrane component
 
Herpetosiphon aurantiacus ATCC 23779
 
Roseiflexus sp. RS-1
 
Roseiflexus castenholzii DSM 13941
binding-protein-dependent transport systems inner membrane component
Chy400_1178
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_1178: binding-protein-dependent transport systems inner membrane component
 
Chloroflexus aggregans DSM 9485

Gene: Cagg_1688: binding-protein-dependent transport systems inner membrane component
 
Herpetosiphon aurantiacus ATCC 23779
 
Roseiflexus sp. RS-1
 
Roseiflexus castenholzii DSM 13941
binding-protein-dependent transport systems inner membrane component
Chy400_1177
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_1177: glycoside hydrolase family 3 domain protein
 
Chloroflexus aggregans DSM 9485

Gene: Cagg_1689: glycoside hydrolase family 3 domain protein
 
Herpetosiphon aurantiacus ATCC 23779
 
Roseiflexus sp. RS-1
 
Roseiflexus castenholzii DSM 13941
glycoside hydrolase family 3 domain protein
Chy400_1176
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_1176: glycoside hydrolase family 16
 
Chloroflexus aggregans DSM 9485

Gene: Cagg_1690: glycoside hydrolase family 16
 
Herpetosiphon aurantiacus ATCC 23779
 
Roseiflexus sp. RS-1
 
Roseiflexus castenholzii DSM 13941
glycoside hydrolase family 16
bglB
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_1175: Beta-glucosidase (EC 3.2.1.21)
 
Chloroflexus aggregans DSM 9485

Gene: Cagg_1691: Beta-glucosidase (EC 3.2.1.21)
 
Herpetosiphon aurantiacus ATCC 23779
 
Roseiflexus sp. RS-1
 
Roseiflexus castenholzii DSM 13941
Beta-glucosidase (EC 3.2.1.21)
Haur_0298
 
Chloroflexus sp. Y-400-fl
 
Chloroflexus aggregans DSM 9485
 
Herpetosiphon aurantiacus ATCC 23779

Gene: Haur_0298: Sugar ABC transport system, sugar-binding protein
 
Roseiflexus sp. RS-1
 
Roseiflexus castenholzii DSM 13941
Sugar ABC transport system, sugar-binding protein
Haur_0299
 
Chloroflexus sp. Y-400-fl
 
Chloroflexus aggregans DSM 9485
 
Herpetosiphon aurantiacus ATCC 23779

Gene: Haur_0299: Sugar ABC transporter permease
 
Roseiflexus sp. RS-1
 
Roseiflexus castenholzii DSM 13941
Sugar ABC transporter permease
Haur_0300
 
Chloroflexus sp. Y-400-fl
 
Chloroflexus aggregans DSM 9485
 
Herpetosiphon aurantiacus ATCC 23779

Gene: Haur_0300: binding-protein-dependent transport systems inner membrane component
 
Roseiflexus sp. RS-1
 
Roseiflexus castenholzii DSM 13941
binding-protein-dependent transport systems inner membrane component
Haur_0301
 
Chloroflexus sp. Y-400-fl
 
Chloroflexus aggregans DSM 9485
 
Herpetosiphon aurantiacus ATCC 23779

Gene: Haur_0301: hypothetical protein
 
Roseiflexus sp. RS-1
 
Roseiflexus castenholzii DSM 13941
hypothetical protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD