Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Caur_3448 - Chloroflexia

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Phylum: Chloroflexi
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 9 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Chloroflexus aggregans DSM 9485 2 1
Chloroflexus sp. Y-400-fl 2 1
Herpetosiphon aurantiacus ATCC 23779 2 1
Roseiflexus castenholzii DSM 13941 2 1
Roseiflexus sp. RS-1 2 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
Caur_3448
*
Chloroflexus aggregans DSM 9485

Site:
position = -57
score = 5.99651
sequence = CTACTTAACCGATTAAGTGG

Site:
position = -41
score = 4.76367
sequence = GTGGTTAATCGGTTAAGTTA

Gene: Cagg_0275: Hypothetical sugar utilization transcriptional regulator , LacI family
*
Chloroflexus sp. Y-400-fl

Site:
position = -50
score = 5.99541
sequence = CCACTTAATCGATTAACCGC

Site:
position = -34
score = 5.50657
sequence = CCGCTTAATCGTTTAACTAA

Gene: Chy400_3712: Hypothetical sugar utilization transcriptional regulator , LacI family
*
Herpetosiphon aurantiacus ATCC 23779

Site:
position = -32
score = 5.69385
sequence = CTATTTAAACGTTTAAATAG

Gene: Haur_0778: Hypothetical sugar utilization transcriptional regulator , LacI family
*
Roseiflexus castenholzii DSM 13941

Site:
position = -34
score = 5.37763
sequence = CCGCTTAACCGTTTCACCCC

Site:
position = -18
score = 4.36141
sequence = CCCCTTAATCGTTTCACGAT

Gene: Rcas_1277: Hypothetical sugar utilization transcriptional regulator , LacI family
*
Roseiflexus sp. RS-1

Site:
position = -34
score = 5.76516
sequence = CCGCTTAATCGTTTCACCGC

Site:
position = -18
score = 5.27633
sequence = CCGCTTAATCGTTTCACCAT

Gene: RoseRS_0524: Hypothetical sugar utilization transcriptional regulator , LacI family
Hypothetical sugar utilization transcriptional regulator , LacI family
ggtA
 
Chloroflexus aggregans DSM 9485

Gene: Cagg_0274: Multiple sugar ABC transporter, ATP-binding protein, orthologs of ggtA-Synechocystis
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_3713: Multiple sugar ABC transporter, ATP-binding protein, orthologs of ggtA-Synechocystis
 
Herpetosiphon aurantiacus ATCC 23779

Gene: Haur_0777: Multiple sugar ABC transporter, ATP-binding protein, orthologs of ggtA-Synechocystis
 
Roseiflexus castenholzii DSM 13941

Gene: Rcas_1278: Multiple sugar ABC transporter, ATP-binding protein, orthologs of ggtA-Synechocystis
 
Roseiflexus sp. RS-1

Gene: RoseRS_0525: Multiple sugar ABC transporter, ATP-binding protein, orthologs of ggtA-Synechocystis
Multiple sugar ABC transporter, ATP-binding protein, orthologs of ggtA-Synechocystis
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD