Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog HTCS_Ara-1 - Bacteroidaceae

Properties
Regulator type: Transcription factor
Regulator family: [Other]
Regulation mode: activator
Biological process: Arabinan utilization
Effector: Arabinan
Phylum: Bacteroidetes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 12 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bacteroides cellulosilyticus DSM 14838 3 1
Bacteroides coprophilus DSM 18228
Bacteroides dorei DSM 17855 6 2
Bacteroides eggerthii DSM 20697 7 2
Bacteroides fragilis NCTC 9343
Bacteroides ovatus ATCC 8483
Bacteroides plebeius DSM 17135 5 2
Bacteroides stercoris ATCC 43183
Bacteroides thetaiotaomicron VPI-5482 9 2
Bacteroides uniformis ATCC 8492
Bacteroides vulgatus ATCC 8482 6 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
abn2
*
Bacteroides cellulosilyticus DSM 14838

Site:
position = -268
score = 7.75675
sequence = TGTCCACCTCAAATGTTCATTTGTCCACCT

Gene: BACCELL_05304: Arabinan endo-1,5-alpha-L-arabinosidase
 
Bacteroides coprophilus DSM 18228
*
Bacteroides dorei DSM 17855

Site:
position = -159
score = 7.44087
sequence = TGTCCACCCTTTAAGCGATATTGTCCACCT

Gene: BACDOR_01716: Arabinan endo-1,5-alpha-L-arabinosidase
*
Bacteroides eggerthii DSM 20697

Site:
position = -285
score = 7.43576
sequence = TGTCCACCTTAAAAGGTCATATATCCACCT

Gene: BACEGG_01542: Arabinan endo-1,5-alpha-L-arabinosidase
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
*
Bacteroides thetaiotaomicron VPI-5482

Site:
position = -69
score = 7.00789
sequence = TGTCCACCAATCGTGTTCGTATGTCCACCT

Gene: BT0367: Arabinan endo-1,5-alpha-L-arabinosidase
 
Bacteroides uniformis ATCC 8492
*
Bacteroides vulgatus ATCC 8482

Site:
position = -169
score = 7.44087
sequence = TGTCCACCCTTTAAGCGATATTGTCCACCT

Gene: BVU_1002: Arabinan endo-1,5-alpha-L-arabinosidase
Arabinan endo-1,5-alpha-L-arabinosidase
abf2
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_05303: Alpha-N-arabinofuranosidase (EC 3.2.1.55)
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855

Gene: BACDOR_01715: Alpha-N-arabinofuranosidase (EC 3.2.1.55)
 
Bacteroides eggerthii DSM 20697

Gene: BACEGG_01543: Alpha-N-arabinofuranosidase (EC 3.2.1.55)
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_01717: Alpha-N-arabinofuranosidase (EC 3.2.1.55)
*
Bacteroides plebeius DSM 17135

Site:
position = -153
score = 6.81732
sequence = TGTCCACCCAATAGAAAAATTTGTCCACCT

Gene: BACPLE_00641: Alpha-N-arabinofuranosidase (EC 3.2.1.55)
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT0368: Alpha-N-arabinofuranosidase (EC 3.2.1.55)
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482

Gene: BVU_1001: Alpha-N-arabinofuranosidase (EC 3.2.1.55)
Alpha-N-arabinofuranosidase (EC 3.2.1.55)
GH43
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_05302: Hypothetical glycoside hydrolase, family 43, similar to arabinosidase
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697

Gene: BACEGG_01544: Hypothetical glycoside hydrolase, family 43, similar to arabinosidase
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT0369: Hypothetical glycoside hydrolase, family 43, similar to arabinosidase
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
Hypothetical glycoside hydrolase, family 43, similar to arabinosidase
 
CRON 2.
lamG
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_05402: Concanavalin A-like lectins/glucanases superfamily
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
*
Bacteroides thetaiotaomicron VPI-5482

Site:
position = -136
score = 7.55285
sequence = TATCCACCTCGAAAATTCATTTGTCCACCT

Gene: BT0365: Concanavalin A-like lectins/glucanases superfamily
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
Concanavalin A-like lectins/glucanases superfamily
susC_Ara-1
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_05403: TonB-dependent outer membrane transporter of arabinan oligosaccharides
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT0364: TonB-dependent outer membrane transporter of arabinan oligosaccharides
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
TonB-dependent outer membrane transporter of arabinan oligosaccharides
susD-Ara-1
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_05404: Outer membrane polysaccharide binding protein for arabinan oligosaccharides
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT0363: Outer membrane polysaccharide binding protein for arabinan oligosaccharides
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
Outer membrane polysaccharide binding protein for arabinan oligosaccharides
susC_Ara-2
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_05405: TonB-dependent outer membrane transporter of arabinan oligosaccharides
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT0362: TonB-dependent outer membrane transporter of arabinan oligosaccharides
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
TonB-dependent outer membrane transporter of arabinan oligosaccharides
susD_Ara-2
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_05406: Outer membrane polysaccharide binding protein for arabinan oligosaccharides
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT0361: Outer membrane polysaccharide binding protein for arabinan oligosaccharides
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
Outer membrane polysaccharide binding protein for arabinan oligosaccharides
abn1
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_05407: Arabinan endo-1,5-alpha-L-arabinosidase
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT0360: Arabinan endo-1,5-alpha-L-arabinosidase
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
Arabinan endo-1,5-alpha-L-arabinosidase
 
CRON 3.
susC_Ara-3
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides coprophilus DSM 18228
*
Bacteroides dorei DSM 17855

Site:
position = -291
score = 7.50156
sequence = CGTCCACCCTATAAAACCGTTTGTCCACCC

Gene: BACDOR_01719: TonB-dependent outer membrane transporter of arabinan oligosaccharides
*
Bacteroides eggerthii DSM 20697

Site:
position = -328
score = 7.33924
sequence = TATCCACCTCTAAAACCCATTTGTCCACCC

Site:
position = -349
score = 6.41777
sequence = TCTCTACACTTAAAATTCGTTTATCCACCT

Gene: BACEGG_01540: TonB-dependent outer membrane transporter of arabinan oligosaccharides
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
*
Bacteroides plebeius DSM 17135

Site:
position = -224
score = 7.76473
sequence = TATCCACCTATAAAATTCGTTTGTCCACCT

Gene: BACPLE_00643: TonB-dependent outer membrane transporter of arabinan oligosaccharides
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482
 
Bacteroides uniformis ATCC 8492
*
Bacteroides vulgatus ATCC 8482

Site:
position = -265
score = 7.50156
sequence = CGTCCACCCTATAAAACCGTTTGTCCACCC

Gene: BVU_1005: TonB-dependent outer membrane transporter of arabinan oligosaccharides
TonB-dependent outer membrane transporter of arabinan oligosaccharides
susD_Ara-3
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855

Gene: BACDOR_01720: Outer membrane polysaccharide binding protein for arabinan oligosaccharides
 
Bacteroides eggerthii DSM 20697

Gene: BACEGG_01539: Outer membrane polysaccharide binding protein for arabinan oligosaccharides
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_00644: Outer membrane polysaccharide binding protein for arabinan oligosaccharides
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482

Gene: BVU_1006: Outer membrane polysaccharide binding protein for arabinan oligosaccharides
Outer membrane polysaccharide binding protein for arabinan oligosaccharides
BACDOR_01721
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855

Gene: BACDOR_01721: hypothetical protein
 
Bacteroides eggerthii DSM 20697

Gene: BACEGG_01538: hypothetical protein
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_00645: hypothetical protein
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482

Gene: BVU_1007: hypothetical protein
hypothetical protein
abn3
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855

Gene: BACDOR_01722: Arabinan endo-1,5-alpha-L-arabinosidase
 
Bacteroides eggerthii DSM 20697

Gene: BACEGG_01537: Arabinan endo-1,5-alpha-L-arabinosidase
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_00646: Arabinan endo-1,5-alpha-L-arabinosidase
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482

Gene: BVU_1008: Arabinan endo-1,5-alpha-L-arabinosidase
Arabinan endo-1,5-alpha-L-arabinosidase
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD