Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog HrcA - Clostridia-2

Properties
Regulator type: Transcription factor
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Clostridium hiranonis DSM 13275 4 2
Clostridium difficile 630 5 2
Clostridium bartlettii DSM 16795 7 3
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
groES
*
Clostridium hiranonis DSM 13275

Site:
position = -84
score = 7.52423
sequence = TTAGCACTCATAGTCTTAGAGTGCTAA

Gene: CLOHIR_00054: Heat shock protein 60 family co-chaperone GroES
*
Clostridium difficile 630

Site:
position = -136
score = 7.06392
sequence = TTAGCACTCTATTAGATAGAGTGATAA

Gene: CD0193: Heat shock protein 60 family co-chaperone GroES
*
Clostridium bartlettii DSM 16795

Site:
position = -93
score = 7.35859
sequence = TTAGCACTCTTACTTAAAGAGTGATAA

Gene: CLOBAR_00663: Heat shock protein 60 family co-chaperone GroES
Heat shock protein 60 family co-chaperone GroES
groEL
 
Clostridium hiranonis DSM 13275

Gene: CLOHIR_00055: Heat shock protein 60 family chaperone GroEL
 
Clostridium difficile 630

Gene: CD0194: Heat shock protein 60 family chaperone GroEL
 
Clostridium bartlettii DSM 16795

Gene: CLOBAR_00662: Heat shock protein 60 family chaperone GroEL
Heat shock protein 60 family chaperone GroEL
 
CRON 2.
hrcA
*
Clostridium hiranonis DSM 13275

Site:
position = -42
score = 7.39933
sequence = TTAGCACTCTTAAACGATGAGTGCTAA

Gene: CLOHIR_02043: Heat-inducible transcription repressor HrcA
*
Clostridium difficile 630

Site:
position = -47
score = 7.20945
sequence = TTAGCACTCGAACTTAGTGAGTGCTAA

Gene: CD2463: Heat-inducible transcription repressor HrcA
*
Clostridium bartlettii DSM 16795

Site:
position = -20
score = 7.34182
sequence = TTAGCACTCGAAAATAGTGAGTGCTAA

Gene: CLOBAR_02734: Heat-inducible transcription repressor HrcA
Heat-inducible transcription repressor HrcA
grpE
 
Clostridium hiranonis DSM 13275

Gene: CLOHIR_02044: Heat shock protein GrpE
 
Clostridium difficile 630

Gene: CD2462: Heat shock protein GrpE
 
Clostridium bartlettii DSM 16795

Gene: CLOBAR_02733: Heat shock protein GrpE
Heat shock protein GrpE
dnaK
 
Clostridium hiranonis DSM 13275
 
Clostridium difficile 630

Gene: CD2461: Chaperone protein DnaK
 
Clostridium bartlettii DSM 16795

Gene: CLOBAR_02732: Chaperone protein DnaK
Chaperone protein DnaK
 
CRON 3.
COG0071
 
Clostridium hiranonis DSM 13275
 
Clostridium difficile 630
*2
Clostridium bartlettii DSM 16795

Gene: CLOBAR_00614: Molecular chaperone (small heat shock protein)

Site:
position = -233
score = 6.79031
sequence = TTAGCACTCTCCTATTGACAGTGCTAA

Site:
position = -52
score = 7.44222
sequence = TTAGCACTCGATAACTTAGAGTGCTAA

Gene: CLOBAR_00615: Molecular chaperone (small heat shock protein)
Molecular chaperone (small heat shock protein)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD