Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog HrcA - Clostridia-1

Properties
Regulator type: Transcription factor
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 20 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Clostridium acetobutylicum ATCC 824 7 3
Clostridium beijerincki NCIMB 8052 6 2
Clostridium botulinum A str. ATCC 3502 7 3
Clostridium butyricum 5521 6 2
Clostridium kluyveri DSM 555 7 3
Clostridium novyi NT 6 2
Clostridium perfringens ATCC 13124 7 3
Clostridium tetani E88 5 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
groES
*
Clostridium acetobutylicum ATCC 824

Site:
position = -106
score = 7.71992
sequence = TTAGCACTCAAGATTAACGAGTGCTAA

Gene: CAC2704: Heat shock protein 60 family co-chaperone GroES
*
Clostridium beijerincki NCIMB 8052

Site:
position = -75
score = 7.62623
sequence = TTAGCACTCGACAATGATGAGTGCTAA

Gene: Cbei_0328: Heat shock protein 60 family co-chaperone GroES
*
Clostridium botulinum A str. ATCC 3502

Site:
position = -84
score = 8.08121
sequence = TTAGCACTCAATATTAATGAGTGCTAA

Gene: CBO3299: Heat shock protein 60 family co-chaperone GroES
*
Clostridium butyricum 5521

Site:
position = -84
score = 7.70192
sequence = TTAGCACTCGATGATGATGAGTGCTAA

Gene: CBY_3050: Heat shock protein 60 family co-chaperone GroES
*
Clostridium kluyveri DSM 555

Site:
position = -84
score = 7.87316
sequence = TTAGCACTCATAATTAATGAGTGCTAA

Gene: CKL_0463: Heat shock protein 60 family co-chaperone GroES
*
Clostridium novyi NT

Site:
position = -82
score = 7.90997
sequence = TTAGCACTCGATGTTATTGAGTGCTAA

Gene: NT01CX_0463: Heat shock protein 60 family co-chaperone GroES
*
Clostridium perfringens ATCC 13124

Site:
position = -64
score = 7.86085
sequence = TTAGCACTCTATATTAATGAGTGCTAA

Gene: CPF_2574: Heat shock protein 60 family co-chaperone GroES
 
Clostridium tetani E88
Heat shock protein 60 family co-chaperone GroES
groEL
 
Clostridium acetobutylicum ATCC 824

Gene: CAC2703: Heat shock protein 60 family chaperone GroEL
 
Clostridium beijerincki NCIMB 8052

Gene: Cbei_0329: Heat shock protein 60 family chaperone GroEL
 
Clostridium botulinum A str. ATCC 3502

Gene: CBO3298: Heat shock protein 60 family chaperone GroEL
 
Clostridium butyricum 5521

Gene: CBY_3051: Heat shock protein 60 family chaperone GroEL
 
Clostridium kluyveri DSM 555

Gene: CKL_0464: Heat shock protein 60 family chaperone GroEL
 
Clostridium novyi NT

Gene: NT01CX_0462: Heat shock protein 60 family chaperone GroEL
 
Clostridium perfringens ATCC 13124

Gene: CPF_2573: Heat shock protein 60 family chaperone GroEL
 
Clostridium tetani E88

Gene: CTC02413: Heat shock protein 60 family chaperone GroEL
Heat shock protein 60 family chaperone GroEL
 
CRON 2.
hrcA
*
Clostridium acetobutylicum ATCC 824

Site:
position = -42
score = 7.56353
sequence = TTAGCACTCAAAGAGAGTGAGTGCTAA

Gene: CAC1280: Heat-inducible transcription repressor HrcA
*
Clostridium beijerincki NCIMB 8052

Site:
position = -44
score = 7.62276
sequence = TTAGCACTCGAGGTTAATGAGTGCTAA

Gene: Cbei_0828: Heat-inducible transcription repressor HrcA
*
Clostridium botulinum A str. ATCC 3502

Site:
position = -48
score = 7.59736
sequence = TTAGCACTCGTTGCTAGTGAGTGCTAA

Gene: CBO2961: Heat-inducible transcription repressor HrcA
*
Clostridium butyricum 5521

Site:
position = -44
score = 7.59736
sequence = TTAGCACTCGCTGCTAATGAGTGCTAA

Gene: CBY_3533: Heat-inducible transcription repressor HrcA
*
Clostridium kluyveri DSM 555

Site:
position = -42
score = 7.63256
sequence = TTAGCACTCAATGCTAGCGAGTGCTAA

Gene: CKL_0900: Heat-inducible transcription repressor HrcA
*
Clostridium novyi NT

Site:
position = -49
score = 7.46091
sequence = TTAGCACTCAACTAAAACGAGTGCTAA

Gene: NT01CX_0059: Heat-inducible transcription repressor HrcA
*
Clostridium perfringens ATCC 13124

Site:
position = -43
score = 7.51997
sequence = TTAGCACTCGTTCAGAGTGAGTGCTAA

Gene: CPF_2292: Heat-inducible transcription repressor HrcA
*
Clostridium tetani E88

Site:
position = -20
score = 7.66069
sequence = TTAGCACTCAACAAGAGTGAGTGCTAA

Gene: CTC02033: Heat-inducible transcription repressor HrcA
Heat-inducible transcription repressor HrcA
grpE
 
Clostridium acetobutylicum ATCC 824

Gene: CAC1281: Heat shock protein GrpE
 
Clostridium beijerincki NCIMB 8052

Gene: Cbei_0829: Heat shock protein GrpE
 
Clostridium botulinum A str. ATCC 3502

Gene: CBO2960: Heat shock protein GrpE
 
Clostridium butyricum 5521

Gene: CBY_3532: Heat shock protein GrpE
 
Clostridium kluyveri DSM 555

Gene: CKL_0901: Heat shock protein GrpE
 
Clostridium novyi NT

Gene: NT01CX_0058: Heat shock protein GrpE
 
Clostridium perfringens ATCC 13124

Gene: CPF_2291: Heat shock protein GrpE
 
Clostridium tetani E88

Gene: CTC02032: Heat shock protein GrpE
Heat shock protein GrpE
dnaK
 
Clostridium acetobutylicum ATCC 824

Gene: CAC1282: Chaperone protein DnaK
 
Clostridium beijerincki NCIMB 8052

Gene: Cbei_0830: Chaperone protein DnaK
 
Clostridium botulinum A str. ATCC 3502

Gene: CBO2959: Chaperone protein DnaK
 
Clostridium butyricum 5521

Gene: CBY_3531: Chaperone protein DnaK
 
Clostridium kluyveri DSM 555

Gene: CKL_0902: Chaperone protein DnaK
 
Clostridium novyi NT

Gene: NT01CX_0057: Chaperone protein DnaK
 
Clostridium perfringens ATCC 13124

Gene: CPF_2290: Chaperone protein DnaK
 
Clostridium tetani E88

Gene: CTC02031: Chaperone protein DnaK
Chaperone protein DnaK
dnaJ
 
Clostridium acetobutylicum ATCC 824

Gene: CAC1283: Chaperone protein DnaJ
 
Clostridium beijerincki NCIMB 8052

Gene: Cbei_0831: Chaperone protein DnaJ
 
Clostridium botulinum A str. ATCC 3502

Gene: CBO2958: Chaperone protein DnaJ
 
Clostridium butyricum 5521

Gene: CBY_3530: Chaperone protein DnaJ
 
Clostridium kluyveri DSM 555

Gene: CKL_0903: Chaperone protein DnaJ
 
Clostridium novyi NT

Gene: NT01CX_0056: Chaperone protein DnaJ
 
Clostridium perfringens ATCC 13124

Gene: CPF_2289: Chaperone protein DnaJ
 
Clostridium tetani E88

Gene: CTC02030: Chaperone protein DnaJ
Chaperone protein DnaJ
 
CRON 3.
htpG
*
Clostridium acetobutylicum ATCC 824

Site:
position = -116
score = 7.6544
sequence = TTAGCACTCGTTGATATAGAGTGCTAA

Gene: CAC3315: Chaperone protein HtpG
 
Clostridium beijerincki NCIMB 8052

Gene: Cbei_4160: Chaperone protein HtpG
*
Clostridium botulinum A str. ATCC 3502

Site:
position = -103
score = 6.99513
sequence = TTAGCACTCACTAGCTTAAAGTGCTAA

Gene: CBO1985: Chaperone protein HtpG
 
Clostridium butyricum 5521

Gene: CBY_3904: Chaperone protein HtpG
*
Clostridium kluyveri DSM 555

Site:
position = -202
score = 7.13376
sequence = TTAGCACTCAAGTATTATAAGTGCTAA

Gene: CKL_2212: Chaperone protein HtpG
 
Clostridium novyi NT
*
Clostridium perfringens ATCC 13124

Site:
position = -63
score = 7.13303
sequence = TTAGCACTCAAGTTGTTAGAGTGCTAA

Gene: CPF_0417: Chaperone protein HtpG
*
Clostridium tetani E88

Site:
position = -71
score = 6.9392
sequence = TTAGCACTCAGCAAATTGGAGTGCTAA

Gene: CTC01489: Chaperone protein HtpG
Chaperone protein HtpG
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD