Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Zur - Clostridia-1

Properties
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 46 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Clostridium acetobutylicum ATCC 824 9 5
Clostridium beijerincki NCIMB 8052 10 6
Clostridium botulinum A str. ATCC 3502 6 4
Clostridium butyricum 5521 5 4
Clostridium kluyveri DSM 555 9 5
Clostridium novyi NT 9 4
Clostridium perfringens ATCC 13124 10 6
Clostridium tetani E88 8 3
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
feoA
 
Clostridium acetobutylicum ATCC 824

Gene: CAC1029: ferrous iron transport protein A
*
Clostridium beijerincki NCIMB 8052

Site:
position = -168
score = 5.41213
sequence = TCATTGAAAATCATTTTCAATGA

Site:
position = -112
score = 5.41561
sequence = TTAATTAAAATCATTATCAATTG

Gene: Cbei_4198: ferrous iron transport protein A
 
Clostridium botulinum A str. ATCC 3502

Gene: CBO1028: ferrous iron transport protein A
*
Clostridium butyricum 5521

Site:
position = -88
score = 6.39161
sequence = ATATTGAAAATTATTTGCATTTA

Gene: CBY_1468: ferrous iron transport protein A
 
Clostridium kluyveri DSM 555

Gene: CKL_1603: ferrous iron transport protein A
*
Clostridium novyi NT

Site:
position = -87
score = 5.58284
sequence = TAAATGAATTTCATTTTCAATTG

Gene: NT01CX_2431: ferrous iron transport protein A
 
Clostridium perfringens ATCC 13124

Gene: CPF_1127: ferrous iron transport protein A
 
Clostridium tetani E88
ferrous iron transport protein A
feoA2
 
Clostridium acetobutylicum ATCC 824

Gene: CAC1030: Ferrous iron transport protein A
 
Clostridium beijerincki NCIMB 8052

Gene: Cbei_4197: Ferrous iron transport protein A
 
Clostridium botulinum A str. ATCC 3502

Gene: CBO1029: Ferrous iron transport protein A
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555

Gene: CKL_1602: Ferrous iron transport protein A
 
Clostridium novyi NT

Gene: NT01CX_2430: Ferrous iron transport protein A
 
Clostridium perfringens ATCC 13124

Gene: CPF_1126: Ferrous iron transport protein A
 
Clostridium tetani E88
Ferrous iron transport protein A
feoB
 
Clostridium acetobutylicum ATCC 824

Gene: CAC1031: Ferrous iron transport protein B
 
Clostridium beijerincki NCIMB 8052

Gene: Cbei_4196: Ferrous iron transport protein B
 
Clostridium botulinum A str. ATCC 3502

Gene: CBO1030: Ferrous iron transport protein B
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555

Gene: CKL_1601: Ferrous iron transport protein B
 
Clostridium novyi NT

Gene: NT01CX_2429: Ferrous iron transport protein B
 
Clostridium perfringens ATCC 13124

Gene: CPF_1125: Ferrous iron transport protein B
 
Clostridium tetani E88

Gene: CTC01207: Ferrous iron transport protein B
Ferrous iron transport protein B
CPF_1128
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
*
Clostridium perfringens ATCC 13124

Site:
position = -85
score = 5.58303
sequence = CAATTGAAAATAATTATCAAATT

Gene: CPF_1128: conserved hypothetical protein
 
Clostridium tetani E88
conserved hypothetical protein
 
CRON 2.
yciC
 
Clostridium acetobutylicum ATCC 824
 2
Clostridium beijerincki NCIMB 8052

Gene: Cbei_2463: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family

Gene: Cbei_1816: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
 
Clostridium botulinum A str. ATCC 3502
 2
Clostridium butyricum 5521

Gene: CBY_1124: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family

Gene: CBY_0946: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
*
Clostridium kluyveri DSM 555

Site:
position = -79
score = 6.43225
sequence = TAAATGCTAATAATTTGCATTTA

Gene: CKL_2453: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
*
Clostridium novyi NT

Site:
position = -57
score = 6.27686
sequence = TTAGTGCAAATGATTTGCATTTG

Gene: NT01CX_2391: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
 
Clostridium perfringens ATCC 13124

Gene: CPF_0043: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
*
Clostridium tetani E88

Site:
position = -34
score = 6.84999
sequence = TAAATGCAAATCATTTGCATTTA

Gene: CTC00941: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
yciC2
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052

Gene: Cbei_1817: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521

Gene: CBY_0945: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT

Gene: NT01CX_2390: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
 
Clostridium perfringens ATCC 13124

Gene: CPF_0044: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
 
Clostridium tetani E88

Gene: CTC00940: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
CAC1592
 
Clostridium acetobutylicum ATCC 824

Gene: CAC1592: ABC transporter, permease protein
*3
Clostridium beijerincki NCIMB 8052

Gene: Cbei_1818: ABC transporter, permease protein

Site:
position = -33
score = 5.5006
sequence = TAAATGCAAATACATTGCAACAA

Gene: Cbei_3261: ABC transporter, permease protein

Gene: Cbei_4662: ABC transporter, permease protein
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521

Gene: CBY_0944: ABC transporter, permease protein
 
Clostridium kluyveri DSM 555

Gene: CKL_2452: ABC transporter, permease protein
 
Clostridium novyi NT

Gene: NT01CX_2389: ABC transporter, permease protein
 
Clostridium perfringens ATCC 13124

Gene: CPF_0045: ABC transporter, permease protein
 
Clostridium tetani E88

Gene: CTC00939: ABC transporter, permease protein
ABC transporter, permease protein
CAC1591
 
Clostridium acetobutylicum ATCC 824

Gene: CAC1591: ABC transporter, substrate-binding protein
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555

Gene: CKL_2451: ABC transporter, substrate-binding protein
 
Clostridium novyi NT

Gene: NT01CX_2388: ABC transporter, substrate-binding protein
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88

Gene: CTC00938: ABC transporter, substrate-binding protein
ABC transporter, substrate-binding protein
znuA
*
Clostridium acetobutylicum ATCC 824

Site:
position = -45
score = 6.35347
sequence = TTAATGCAAATTATTTGCAAGTA

Gene: CAC1593: Zinc ABC transporter, periplasmic-binding protein ZnuA
*2
Clostridium beijerincki NCIMB 8052

Site:
position = -34
score = 5.61723
sequence = CAAATGCAAATCGTATGCATGTG

Gene: Cbei_4668: Zinc ABC transporter, periplasmic-binding protein ZnuA

Site:
position = -34
score = 5.11485
sequence = CAAATGCAAATCAGATGCAAACT

Gene: Cbei_0477: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Clostridium botulinum A str. ATCC 3502

Site:
position = -86
score = 6.38262
sequence = TAAATGCAAATAGTTTGCAATAA

Gene: CBO1363: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Clostridium butyricum 5521

Site:
position = -33
score = 5.88934
sequence = CAAATGCAAATCATATGCAAAAT

Gene: CBY_3975: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Clostridium kluyveri DSM 555

Site:
position = -53
score = 5.92987
sequence = TAGATGCAAACCATTTGCATCTA

Gene: CKL_3051: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Clostridium novyi NT
*
Clostridium perfringens ATCC 13124

Site:
position = -32
score = 5.57449
sequence = ATAATGCGAATCATTTGCAAACA

Gene: CPF_2413: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Clostridium tetani E88

Site:
position = -105
score = 5.93972
sequence = TACTTGCAAATAGTTTGCAATAT

Site:
position = -40
score = 6.06906
sequence = TAAATGCAAACGATTTGCAAAAG

Gene: CTC02360: Zinc ABC transporter, periplasmic-binding protein ZnuA
Zinc ABC transporter, periplasmic-binding protein ZnuA
zupT
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521

Gene: CBY_3818: zinc transporter ZupT
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
*
Clostridium perfringens ATCC 13124

Site:
position = -55
score = 5.9405
sequence = TAATTGAAAATAATTATCAATTG

Gene: CPF_0717: zinc transporter ZupT
 
Clostridium tetani E88
zinc transporter ZupT
 
CRON 3.
znuC
*
Clostridium acetobutylicum ATCC 824

Site:
position = -81
score = 6.30751
sequence = TACTTGCAAATGATTTGCATTAT

Gene: CAC2877: Zinc ABC transporter, ATP-binding protein ZnuC
*
Clostridium beijerincki NCIMB 8052

Site:
position = -60
score = 6.39388
sequence = CTATTGCAAATTATTTGCATTTG

Gene: Cbei_4334: Zinc ABC transporter, ATP-binding protein ZnuC
*
Clostridium botulinum A str. ATCC 3502

Site:
position = -157
score = 6.38262
sequence = TTATTGCAAACTATTTGCATTTA

Gene: CBO1362: Zinc ABC transporter, ATP-binding protein ZnuC
*
Clostridium butyricum 5521

Site:
position = -128
score = 6.04486
sequence = ATATTGCAAATCATTTGCAGATA

Gene: CBY_3660: Zinc ABC transporter, ATP-binding protein ZnuC
*
Clostridium kluyveri DSM 555

Site:
position = -112
score = 5.76846
sequence = TATTTGCAAATCACTTGCAACTA

Gene: CKL_2905: Zinc ABC transporter, ATP-binding protein ZnuC
 
Clostridium novyi NT
*
Clostridium perfringens ATCC 13124

Site:
position = -74
score = 6.19453
sequence = AAAATGCAAATTATTTGCACTTG

Gene: CPF_1709: Zinc ABC transporter, ATP-binding protein ZnuC
*
Clostridium tetani E88

Site:
position = -38
score = 5.93972
sequence = ATATTGCAAACTATTTGCAAGTA

Site:
position = -103
score = 6.06906
sequence = CTTTTGCAAATCGTTTGCATTTA

Gene: CTC02361: Zinc ABC transporter, ATP-binding protein ZnuC
Zinc ABC transporter, ATP-binding protein ZnuC
znuB
 
Clostridium acetobutylicum ATCC 824

Gene: CAC2878: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Clostridium beijerincki NCIMB 8052

Gene: Cbei_4335: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Clostridium botulinum A str. ATCC 3502

Gene: CBO1361: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Clostridium butyricum 5521

Gene: CBY_3661: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Clostridium kluyveri DSM 555

Gene: CKL_2906: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124

Gene: CPF_1710: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Clostridium tetani E88

Gene: CTC02362: Zinc ABC transporter, inner membrane permease protein ZnuB
Zinc ABC transporter, inner membrane permease protein ZnuB
zur
*
Clostridium acetobutylicum ATCC 824

Site:
position = -108
score = 4.77343
sequence = TTTATTAAAACCATTTTCTTTTA

Gene: CAC2634: Zinc homeostasis transcriptional regulator Zur, Fur family
 
Clostridium beijerincki NCIMB 8052

Gene: Cbei_1336: Zinc homeostasis transcriptional regulator Zur, Fur family
 
Clostridium botulinum A str. ATCC 3502

Gene: CBO3220: Zinc homeostasis transcriptional regulator Zur, Fur family
 
Clostridium butyricum 5521

Gene: CBY_0017: Zinc homeostasis transcriptional regulator Zur, Fur family
 
Clostridium kluyveri DSM 555

Gene: CKL_3342: Zinc homeostasis transcriptional regulator Zur, Fur family
 
Clostridium novyi NT

Gene: NT01CX_0363: Zinc homeostasis transcriptional regulator Zur, Fur family
 
Clostridium perfringens ATCC 13124

Gene: CPF_1420: Zinc homeostasis transcriptional regulator Zur, Fur family
*
Clostridium tetani E88

Site:
position = -89
score = 4.92665
sequence = ATATTGAATAGCATTTGAAAATA

Gene: CTC02363: Zinc homeostasis transcriptional regulator Zur, Fur family
Zinc homeostasis transcriptional regulator Zur, Fur family
 
CRON 4.
rpsD2
*2
Clostridium acetobutylicum ATCC 824

Site:
position = -111
score = 5.40737
sequence = CAAATGAAAAATATTCTCATTTA

Site:
position = -193
score = 5.35974
sequence = TAATTGATAATTATTATCATATG

Gene: CAC1478: SSU ribosomal protein S4p paralog

Gene: CAC1594: SSU ribosomal protein S4p paralog
 
Clostridium beijerincki NCIMB 8052
*
Clostridium botulinum A str. ATCC 3502

Site:
position = -92
score = 5.84578
sequence = ATATTGAAAATCATTTTCAGTTT

Gene: CBO3405: SSU ribosomal protein S4p paralog
*
Clostridium butyricum 5521

Site:
position = -101
score = 5.62275
sequence = AAAATGATAATGAATTTCATTTA

Site:
position = -95
score = 5.11667
sequence = ATAATGAATTTCATTTACATTTA

Gene: CBY_3339: SSU ribosomal protein S4p paralog
*
Clostridium kluyveri DSM 555

Site:
position = -152
score = 5.78945
sequence = ATATTGAACATCATTTTCAATTA

Gene: CKL_2190: SSU ribosomal protein S4p paralog
 
Clostridium novyi NT

Gene: NT01CX_2339: SSU ribosomal protein S4p paralog
*
Clostridium perfringens ATCC 13124

Site:
position = -81
score = 5.84592
sequence = ATAATGATAATCATTTTCAATAA

Gene: CPF_2668: SSU ribosomal protein S4p paralog
 
Clostridium tetani E88
SSU ribosomal protein S4p paralog
 
CRON 5.
fld
*
Clostridium acetobutylicum ATCC 824

Site:
position = -51
score = 5.09462
sequence = ATAATGAAAATCAATATCAACAA

Gene: CAC0587: Flavodoxin
*
Clostridium beijerincki NCIMB 8052

Site:
position = -53
score = 5.61085
sequence = TAATTGAGAATGATTTTCAAAAT

Gene: Cbei_2410: Flavodoxin
*
Clostridium botulinum A str. ATCC 3502

Site:
position = -78
score = 5.20863
sequence = TAAATGAAATTGATTCTCACTTT

Gene: CBO0346: Flavodoxin
 
Clostridium butyricum 5521
*
Clostridium kluyveri DSM 555

Site:
position = -56
score = 5.7145
sequence = TATATGATAATGATTTTCATTAT

Gene: CKL_2165: Flavodoxin
*
Clostridium novyi NT

Site:
position = -40
score = 5.23497
sequence = AATATGAAAATGATAATCAATAT

Site:
position = -34
score = 5.16087
sequence = AAAATGATAATCAATATCAATAA

Gene: NT01CX_2337: Flavodoxin
*
Clostridium perfringens ATCC 13124

Site:
position = -54
score = 5.97432
sequence = TAATTGAAATTGATTTTCATTAA

Site:
position = -121
score = 5.99146
sequence = TTATTGAAAATTATTATCATTTA

Gene: CPF_0625: Flavodoxin
 
Clostridium tetani E88

Gene: CTC00430: Flavodoxin
Flavodoxin
CAC0588
 
Clostridium acetobutylicum ATCC 824

Gene: CAC0588: conserved hypothetical protein
 
Clostridium beijerincki NCIMB 8052

Gene: Cbei_2411: conserved hypothetical protein
 
Clostridium botulinum A str. ATCC 3502

Gene: CBO0347: conserved hypothetical protein
 
Clostridium butyricum 5521

Gene: CBY_0737: conserved hypothetical protein
 
Clostridium kluyveri DSM 555

Gene: CKL_2164: conserved hypothetical protein
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124

Gene: CPF_0624: conserved hypothetical protein
 
Clostridium tetani E88

Gene: CTC00782: conserved hypothetical protein
conserved hypothetical protein
 
CRON 6.
znuA2
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
*
Clostridium novyi NT

Site:
position = -175
score = 4.99181
sequence = TATATGAAAAACATTGTCATTAT

Site:
position = -42
score = 6.3804
sequence = TTTTTGCAAATGATTTGCATTTT

Gene: NT01CX_0482: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
Zinc ABC transporter, periplasmic-binding protein ZnuA
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD