Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog HrcA - Clostridia-3

Properties
Regulator type: Transcription factor
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 81 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bacteroides pectinophilus ATCC 43243 9 4
Blautia hansenii DSM 20583 7 4
Bryantella formatexigens DSM 14469 8 6
Clostridiales bacterium 1_7_47_FAA 9 5
Clostridium bolteae ATCC BAA-613 11 6
Clostridium nexile DSM 1787 7 6
Clostridium scindens ATCC 35704 9 6
Dorea formicigenerans ATCC 27755 10 5
Dorea longicatena DSM 13814 13 8
Eubacterium eligens ATCC 27750 9 5
Eubacterium rectale ATCC 33656 16 8
Roseburia intestinalis L1-82 8 5
Ruminococcus gnavus ATCC 29149 11 6
Ruminococcus lactaris ATCC 29176 9 6
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
EUBREC_1574
 
Bacteroides pectinophilus ATCC 43243
 
Blautia hansenii DSM 20583
 
Bryantella formatexigens DSM 14469
 
Clostridiales bacterium 1_7_47_FAA
 
Clostridium bolteae ATCC BAA-613
 
Clostridium nexile DSM 1787
 
Clostridium scindens ATCC 35704
 
Dorea formicigenerans ATCC 27755
 
Dorea longicatena DSM 13814
 
Eubacterium eligens ATCC 27750
*
Eubacterium rectale ATCC 33656

Site:
position = -400
score = 7.50554
sequence = TTAGCACTCACTATTTTTGAGTGCTAA

Gene: EUBREC_1574: hypothetical protein
 
Roseburia intestinalis L1-82
 
Ruminococcus gnavus ATCC 29149
 
Ruminococcus lactaris ATCC 29176
hypothetical protein
htpG
*
Bacteroides pectinophilus ATCC 43243

Site:
position = -98
score = 7.07084
sequence = TTAGCACTCTTTTATAATGAGTGCTGA

Gene: BACPEC_00901: Heat shock chaperone protein 90
*
Blautia hansenii DSM 20583

Site:
position = -98
score = 7.31099
sequence = TTAGCACTCAATATGATTGAGTGCTAA

Gene: BLAHAN_03125: Heat shock chaperone protein 90
*
Bryantella formatexigens DSM 14469

Site:
position = -111
score = 7.46074
sequence = TTAGCACTCACCTAAAATGAGTGCTAA

Gene: BRYFOR_02916: Heat shock chaperone protein 90
*
Clostridiales bacterium 1_7_47_FAA

Site:
position = -131
score = 7.49179
sequence = TTAGCACTCAATAAAAATGAGTGCTAA

Gene: Cbac1_010100019775: Heat shock chaperone protein 90
*
Clostridium bolteae ATCC BAA-613

Site:
position = -130
score = 7.45168
sequence = TTAGCACTCAACAAAAATGAGTGCTAA

Gene: CLOBOL_06029: Heat shock chaperone protein 90
*
Clostridium nexile DSM 1787

Site:
position = -92
score = 7.48207
sequence = TTAGCACTCACTTTAAAAGAGTGCTAA

Gene: CLONEX_03837: Heat shock chaperone protein 90
 
Clostridium scindens ATCC 35704
*
Dorea formicigenerans ATCC 27755

Site:
position = -156
score = 7.16624
sequence = TTAGCACTCGATGAAAAAGAGTGCTAA

Gene: DORFOR_02548: Heat shock chaperone protein 90
*
Dorea longicatena DSM 13814

Site:
position = -171
score = 7.43611
sequence = TTAGCACTCTTTTTAAAAGAGTGCTAA

Gene: DORLON_02814: Heat shock chaperone protein 90
*
Eubacterium eligens ATCC 27750

Site:
position = -105
score = 7.26628
sequence = TTAGCACTCTTATTTAAGGAGTGCTAA

Gene: EUBELI_01321: Heat shock chaperone protein 90
 
Eubacterium rectale ATCC 33656

Gene: EUBREC_1573: Heat shock chaperone protein 90
*
Roseburia intestinalis L1-82

Site:
position = -132
score = 7.07084
sequence = TTAGCACTCATTAAAAAAGAGTGCTGA

Gene: ROSINTL182_03168: Heat shock chaperone protein 90
*
Ruminococcus gnavus ATCC 29149

Site:
position = -34
score = 7.37991
sequence = TTAGCACTCAACTGAAAAGAGTGCTAA

Gene: RUMGNA_00155: Heat shock chaperone protein 90
*
Ruminococcus lactaris ATCC 29176

Site:
position = -96
score = 7.42146
sequence = TTAGCACTCTATTTAAAAGAGTGCTAA

Gene: RUMLAC_00300: Heat shock chaperone protein 90
Heat shock chaperone protein 90
 
CRON 2.
groES
*
Bacteroides pectinophilus ATCC 43243

Site:
position = -56
score = 7.15525
sequence = TTAGCACTCGAGATAAATGAGTGCTAA

Gene: BACPEC_01132: Heat shock protein 60 family co-chaperone GroES
*
Blautia hansenii DSM 20583

Site:
position = -16
score = 7.25325
sequence = TTAGCACTCAATTGCAATGAGTGCTAA

Gene: BLAHAN_00278: Heat shock protein 60 family co-chaperone GroES
*
Bryantella formatexigens DSM 14469

Site:
position = -41
score = 7.31025
sequence = TTAGCACTCGACTGAAATGAGTGCTAA

Gene: BRYFOR_04762: Heat shock protein 60 family co-chaperone GroES
*
Clostridiales bacterium 1_7_47_FAA

Site:
position = -126
score = 6.99772
sequence = TTAGCACTCAAGTCTTGACAGTGCTAA

Gene: Cbac1_010100016738: Heat shock protein 60 family co-chaperone GroES
*
Clostridium bolteae ATCC BAA-613

Site:
position = -124
score = 7.20571
sequence = TTAGCACTCAACTCTTGACAGTGCTAA

Gene: CLOBOL_06802: Heat shock protein 60 family co-chaperone GroES
*
Clostridium nexile DSM 1787

Site:
position = -63
score = 6.96648
sequence = TTAGCACTCGGACAAAGTGAGTGCTAA

Gene: CLONEX_00415: Heat shock protein 60 family co-chaperone GroES
*
Clostridium scindens ATCC 35704

Site:
position = -58
score = 7.46864
sequence = TTAGCACTCTCTTTTTATGAGTGCTAA

Gene: CLOSCI_00049: Heat shock protein 60 family co-chaperone GroES
*
Dorea formicigenerans ATCC 27755

Site:
position = -16
score = 6.98292
sequence = ATAGCACTCTCTTTTTATGAGTGCTAA

Gene: DORFOR_00902: Heat shock protein 60 family co-chaperone GroES
*
Dorea longicatena DSM 13814

Site:
position = -59
score = 7.04325
sequence = TCAGCACTCTCTTTTGTTGAGTGCTAA

Gene: DORLON_01664: Heat shock protein 60 family co-chaperone GroES
*
Eubacterium eligens ATCC 27750

Site:
position = -16
score = 7.19101
sequence = TTAGCACTCGAAAAGAATGAGTGCTAA

Gene: EUBELI_00519: Heat shock protein 60 family co-chaperone GroES
*
Eubacterium rectale ATCC 33656

Site:
position = -20
score = 7.33694
sequence = TTAGCACTCGAAAGAAATGAGTGCTAA

Gene: EUBREC_2271: Heat shock protein 60 family co-chaperone GroES
*
Roseburia intestinalis L1-82

Site:
position = -78
score = 7.42538
sequence = TTAGCACTCAAAAGAAATGAGTGCTAA

Gene: ROSINTL182_02484: Heat shock protein 60 family co-chaperone GroES
*
Ruminococcus gnavus ATCC 29149

Site:
position = -54
score = 7.14875
sequence = TTAGCACTCGATATGAACGAGTGCTAA

Gene: RUMGNA_02096: Heat shock protein 60 family co-chaperone GroES
*
Ruminococcus lactaris ATCC 29176

Site:
position = -54
score = 7.17192
sequence = TTAGCACTCAAGTGAAAAGAGTGCTAA

Gene: RUMLAC_02470: Heat shock protein 60 family co-chaperone GroES
Heat shock protein 60 family co-chaperone GroES
groEL
 
Bacteroides pectinophilus ATCC 43243

Gene: BACPEC_01131: Heat shock protein 60 family chaperone GroEL
*
Blautia hansenii DSM 20583

Site:
position = -388
score = 7.25325
sequence = TTAGCACTCAATTGCAATGAGTGCTAA

Gene: BLAHAN_00277: Heat shock protein 60 family chaperone GroEL
*
Bryantella formatexigens DSM 14469

Site:
position = -359
score = 7.31025
sequence = TTAGCACTCGACTGAAATGAGTGCTAA

Gene: BRYFOR_04763: Heat shock protein 60 family chaperone GroEL
 
Clostridiales bacterium 1_7_47_FAA

Gene: Cbac1_010100016743: Heat shock protein 60 family chaperone GroEL
 
Clostridium bolteae ATCC BAA-613

Gene: CLOBOL_06801: Heat shock protein 60 family chaperone GroEL
*
Clostridium nexile DSM 1787

Site:
position = -375
score = 6.96648
sequence = TTAGCACTCGGACAAAGTGAGTGCTAA

Gene: CLONEX_00414: Heat shock protein 60 family chaperone GroEL
*
Clostridium scindens ATCC 35704

Site:
position = -397
score = 7.46864
sequence = TTAGCACTCTCTTTTTATGAGTGCTAA

Gene: CLOSCI_00050: Heat shock protein 60 family chaperone GroEL
 
Dorea formicigenerans ATCC 27755

Gene: DORFOR_00901: Heat shock protein 60 family chaperone GroEL
*
Dorea longicatena DSM 13814

Site:
position = -383
score = 7.04325
sequence = TCAGCACTCTCTTTTGTTGAGTGCTAA

Gene: DORLON_01663: Heat shock protein 60 family chaperone GroEL
 
Eubacterium eligens ATCC 27750

Gene: EUBELI_00520: Heat shock protein 60 family chaperone GroEL
 
Eubacterium rectale ATCC 33656

Gene: EUBREC_2270: Heat shock protein 60 family chaperone GroEL
 2
Roseburia intestinalis L1-82

Gene: ROSINTL182_02483: Heat shock protein 60 family chaperone GroEL

Gene: ROSINTL182_02482: Heat shock protein 60 family chaperone GroEL
*
Ruminococcus gnavus ATCC 29149

Site:
position = -395
score = 7.14875
sequence = TTAGCACTCGATATGAACGAGTGCTAA

Gene: RUMGNA_02097: Heat shock protein 60 family chaperone GroEL
*
Ruminococcus lactaris ATCC 29176

Site:
position = -372
score = 7.17192
sequence = TTAGCACTCAAGTGAAAAGAGTGCTAA

Gene: RUMLAC_02471: Heat shock protein 60 family chaperone GroEL
Heat shock protein 60 family chaperone GroEL
 
CRON 3.
hrcA
*
Bacteroides pectinophilus ATCC 43243

Site:
position = -20
score = 7.09093
sequence = TTAGCACTCCACAACAATGAGTGCTAA

Gene: BACPEC_00937: heat-inducible transcription repressor HrcA
*
Blautia hansenii DSM 20583

Site:
position = -51
score = 6.80357
sequence = TTAGCACTCCACCACAACGAGTGCTAA

Gene: BLAHAN_00302: heat-inducible transcription repressor HrcA
*
Bryantella formatexigens DSM 14469

Site:
position = -52
score = 7.16542
sequence = TTAGCACTCGATTCGAAAGAGTGCTAA

Gene: BRYFOR_00981: heat-inducible transcription repressor HrcA
*
Clostridiales bacterium 1_7_47_FAA

Site:
position = -51
score = 6.75077
sequence = TTAGCACTCCTCGAAACCGAGTGCTAA

Gene: Cbac1_010100002312: heat-inducible transcription repressor HrcA
*
Clostridium bolteae ATCC BAA-613

Site:
position = -16
score = 6.87
sequence = TTAGCACTCCCGAACGTTGAGTGCTAA

Gene: CLOBOL_02018: heat-inducible transcription repressor HrcA
*2
Clostridium nexile DSM 1787

Site:
position = -54
score = 7.30351
sequence = TTAGCACTCGAAAGAATAGAGTGCTAA

Gene: CLONEX_00290: heat-inducible transcription repressor HrcA

Gene: CLONEX_00289: heat-inducible transcription repressor HrcA
*
Clostridium scindens ATCC 35704

Site:
position = -54
score = 7.31638
sequence = TTAGCACTCGAAAATGTAGAGTGCTAA

Gene: CLOSCI_01188: heat-inducible transcription repressor HrcA
*
Dorea formicigenerans ATCC 27755

Site:
position = -16
score = 7.27042
sequence = TTAGCACTCCAATATAATGAGTGCTAA

Gene: DORFOR_00808: heat-inducible transcription repressor HrcA
*
Dorea longicatena DSM 13814

Site:
position = -74
score = 7.17511
sequence = TTAGCACTCAGATAAAAAGAGTGCTAA

Gene: DORLON_01874: heat-inducible transcription repressor HrcA
*
Eubacterium eligens ATCC 27750

Site:
position = -16
score = 7.21008
sequence = TTAGCACTCCAATCTGATGAGTGCTAA

Gene: EUBELI_01362: heat-inducible transcription repressor HrcA
*
Eubacterium rectale ATCC 33656

Site:
position = -123
score = 6.23799
sequence = TTAGCACTCGAGGGTTGACATTGCTAA

Site:
position = -64
score = 7.05079
sequence = TTAGCACTCCAAAATACAGAGTGCTAA

Gene: EUBREC_1909: heat-inducible transcription repressor HrcA
*
Roseburia intestinalis L1-82

Site:
position = -58
score = 7.30924
sequence = TTAGCACTCCACAATAATGAGTGCTAA

Gene: ROSINTL182_03539: heat-inducible transcription repressor HrcA
*
Ruminococcus gnavus ATCC 29149

Site:
position = -20
score = 7.25019
sequence = TTAGCACTCAAAACAAAGGAGTGCTAA

Gene: RUMGNA_00418: heat-inducible transcription repressor HrcA
*
Ruminococcus lactaris ATCC 29176

Site:
position = -68
score = 7.0918
sequence = TTAGCACTCAAAAGCAGGGAGTGCTAA

Gene: RUMLAC_02656: heat-inducible transcription repressor HrcA
heat-inducible transcription repressor HrcA
grpE
 
Bacteroides pectinophilus ATCC 43243

Gene: BACPEC_00936: Heat shock protein GrpE
 
Blautia hansenii DSM 20583

Gene: BLAHAN_00301: Heat shock protein GrpE
 
Bryantella formatexigens DSM 14469

Gene: BRYFOR_00982: Heat shock protein GrpE
 
Clostridiales bacterium 1_7_47_FAA

Gene: Cbac1_010100002307: Heat shock protein GrpE
 
Clostridium bolteae ATCC BAA-613

Gene: CLOBOL_02017: Heat shock protein GrpE
 
Clostridium nexile DSM 1787

Gene: CLONEX_00288: Heat shock protein GrpE
 
Clostridium scindens ATCC 35704

Gene: CLOSCI_01189: Heat shock protein GrpE
 
Dorea formicigenerans ATCC 27755

Gene: DORFOR_00807: Heat shock protein GrpE
 
Dorea longicatena DSM 13814

Gene: DORLON_01873: Heat shock protein GrpE
 
Eubacterium eligens ATCC 27750

Gene: EUBELI_01361: Heat shock protein GrpE
 
Eubacterium rectale ATCC 33656

Gene: EUBREC_1908: Heat shock protein GrpE
 
Roseburia intestinalis L1-82

Gene: ROSINTL182_03540: Heat shock protein GrpE
 
Ruminococcus gnavus ATCC 29149

Gene: RUMGNA_00416: Heat shock protein GrpE
 
Ruminococcus lactaris ATCC 29176

Gene: RUMLAC_02655: Heat shock protein GrpE
Heat shock protein GrpE
EUBREC_1907
 
Bacteroides pectinophilus ATCC 43243
 
Blautia hansenii DSM 20583
 
Bryantella formatexigens DSM 14469
 
Clostridiales bacterium 1_7_47_FAA
 
Clostridium bolteae ATCC BAA-613
 
Clostridium nexile DSM 1787
 
Clostridium scindens ATCC 35704
 
Dorea formicigenerans ATCC 27755
 
Dorea longicatena DSM 13814
 
Eubacterium eligens ATCC 27750
 
Eubacterium rectale ATCC 33656

Gene: EUBREC_1907: hypothetical protein
 
Roseburia intestinalis L1-82
 
Ruminococcus gnavus ATCC 29149
 
Ruminococcus lactaris ATCC 29176
hypothetical protein
dnaK
 
Bacteroides pectinophilus ATCC 43243

Gene: BACPEC_00935: Chaperone protein DnaK
 
Blautia hansenii DSM 20583

Gene: BLAHAN_00300: Chaperone protein DnaK
 
Bryantella formatexigens DSM 14469

Gene: BRYFOR_00983: Chaperone protein DnaK
 
Clostridiales bacterium 1_7_47_FAA

Gene: Cbac1_010100002302: Chaperone protein DnaK
 
Clostridium bolteae ATCC BAA-613

Gene: CLOBOL_02016: Chaperone protein DnaK
 
Clostridium nexile DSM 1787

Gene: CLONEX_00287: Chaperone protein DnaK
 
Clostridium scindens ATCC 35704

Gene: CLOSCI_01190: Chaperone protein DnaK
 
Dorea formicigenerans ATCC 27755

Gene: DORFOR_00806: Chaperone protein DnaK
 
Dorea longicatena DSM 13814

Gene: DORLON_01872: Chaperone protein DnaK
 
Eubacterium eligens ATCC 27750

Gene: EUBELI_01360: Chaperone protein DnaK
 
Eubacterium rectale ATCC 33656

Gene: EUBREC_1906: Chaperone protein DnaK
 
Roseburia intestinalis L1-82
 
Ruminococcus gnavus ATCC 29149

Gene: RUMGNA_00415: Chaperone protein DnaK
 
Ruminococcus lactaris ATCC 29176

Gene: RUMLAC_02654: Chaperone protein DnaK
Chaperone protein DnaK
dnaJ
 2
Bacteroides pectinophilus ATCC 43243

Gene: BACPEC_00934: Chaperone protein DnaJ

Gene: BACPEC_00933: Chaperone protein DnaJ
 
Blautia hansenii DSM 20583

Gene: BLAHAN_00299: Chaperone protein DnaJ
 
Bryantella formatexigens DSM 14469

Gene: BRYFOR_00984: Chaperone protein DnaJ
 
Clostridiales bacterium 1_7_47_FAA

Gene: Cbac1_010100002297: Chaperone protein DnaJ
 
Clostridium bolteae ATCC BAA-613

Gene: CLOBOL_02015: Chaperone protein DnaJ
 
Clostridium nexile DSM 1787

Gene: CLONEX_00286: Chaperone protein DnaJ
 
Clostridium scindens ATCC 35704

Gene: CLOSCI_01191: Chaperone protein DnaJ
 
Dorea formicigenerans ATCC 27755

Gene: DORFOR_00805: Chaperone protein DnaJ
 
Dorea longicatena DSM 13814

Gene: DORLON_01871: Chaperone protein DnaJ
 
Eubacterium eligens ATCC 27750

Gene: EUBELI_01359: Chaperone protein DnaJ
 2
Eubacterium rectale ATCC 33656

Gene: EUBREC_1905: Chaperone protein DnaJ

Gene: EUBREC_1904: Chaperone protein DnaJ
 
Roseburia intestinalis L1-82

Gene: ROSINTL182_03543: Chaperone protein DnaJ
 
Ruminococcus gnavus ATCC 29149

Gene: RUMGNA_00414: Chaperone protein DnaJ
 
Ruminococcus lactaris ATCC 29176

Gene: RUMLAC_02653: Chaperone protein DnaJ
Chaperone protein DnaJ
RUMGNA_00417
 
Bacteroides pectinophilus ATCC 43243
 
Blautia hansenii DSM 20583
 
Bryantella formatexigens DSM 14469
 
Clostridiales bacterium 1_7_47_FAA
 
Clostridium bolteae ATCC BAA-613
 
Clostridium nexile DSM 1787
 
Clostridium scindens ATCC 35704
 
Dorea formicigenerans ATCC 27755
 
Dorea longicatena DSM 13814
 
Eubacterium eligens ATCC 27750
 
Eubacterium rectale ATCC 33656
 
Roseburia intestinalis L1-82
 
Ruminococcus gnavus ATCC 29149

Gene: RUMGNA_00417: hypothetical protein
 
Ruminococcus lactaris ATCC 29176
hypothetical protein
 
CRON 4.
clpB
 
Bacteroides pectinophilus ATCC 43243

Gene: BACPEC_02180: ATP-dependent Clp protease ATP-binding subunit ClpB
 
Blautia hansenii DSM 20583

Gene: BLAHAN_00556: ATP-dependent Clp protease ATP-binding subunit ClpB
 
Bryantella formatexigens DSM 14469

Gene: BRYFOR_00026: ATP-dependent Clp protease ATP-binding subunit ClpB
*
Clostridiales bacterium 1_7_47_FAA

Site:
position = -166
score = 7.08138
sequence = TTAGCACTCACCCCTTGACAGTGCTAA

Gene: Cbac1_010100022827: ATP-dependent Clp protease ATP-binding subunit ClpB
*
Clostridium bolteae ATCC BAA-613

Site:
position = -149
score = 6.95111
sequence = TTAGCACTCGACCCTTGACAGTGCTAA

Gene: CLOBOL_01718: ATP-dependent Clp protease ATP-binding subunit ClpB
*
Clostridium nexile DSM 1787

Site:
position = -89
score = 7.08138
sequence = TTAGCACTCACCCCTTGACAGTGCTAA

Gene: CLONEX_03685: ATP-dependent Clp protease ATP-binding subunit ClpB
*
Clostridium scindens ATCC 35704

Site:
position = -94
score = 7.24753
sequence = TTAGCACTCACCTCTTGACAGTGCTAA

Gene: CLOSCI_02798: ATP-dependent Clp protease ATP-binding subunit ClpB
*
Dorea formicigenerans ATCC 27755

Site:
position = -84
score = 6.76181
sequence = TTAGCACTCACCTCTTGACTGTGCTAA

Gene: DORFOR_02181: ATP-dependent Clp protease ATP-binding subunit ClpB
*
Dorea longicatena DSM 13814

Site:
position = -84
score = 6.50476
sequence = TTAGCACTCGGGGGTTGACAGTGCTAA

Gene: DORLON_02511: ATP-dependent Clp protease ATP-binding subunit ClpB
*
Eubacterium eligens ATCC 27750

Site:
position = -115
score = 7.24753
sequence = TTAGCACTCACCTCTTGACAGTGCTAA

Gene: EUBELI_01260: ATP-dependent Clp protease ATP-binding subunit ClpB
*
Eubacterium rectale ATCC 33656

Site:
position = -133
score = 7.17394
sequence = TTAGCACTCTCACTTGACGAGTGCTAA

Gene: EUBREC_2562: ATP-dependent Clp protease ATP-binding subunit ClpB
*
Roseburia intestinalis L1-82

Site:
position = -157
score = 7.24753
sequence = TTAGCACTCACCTCTTGACAGTGCTAA

Gene: ROSINTL182_02758: ATP-dependent Clp protease ATP-binding subunit ClpB
*
Ruminococcus gnavus ATCC 29149

Site:
position = -83
score = 5.63384
sequence = TTAGCACTCTTCTCTTGACGTGGCTAA

Gene: RUMGNA_00181: ATP-dependent Clp protease ATP-binding subunit ClpB
*
Ruminococcus lactaris ATCC 29176

Site:
position = -95
score = 7.16389
sequence = TTAGCACTCAACTCTTTACAGTGCTAA

Gene: RUMLAC_01141: ATP-dependent Clp protease ATP-binding subunit ClpB
ATP-dependent Clp protease ATP-binding subunit ClpB
 
CRON 5.
hsp20
*
Bacteroides pectinophilus ATCC 43243

Site:
position = -188
score = 7.24753
sequence = TTAGCACTCACCTCTTGACAGTGCTAA

Gene: BACPEC_02725: Heat shock protein Hsp20
 
Blautia hansenii DSM 20583

Gene: BLAHAN_00905: Heat shock protein Hsp20
*2
Bryantella formatexigens DSM 14469

Site:
position = -153
score = 7.06371
sequence = TTAGCACTCCCTCTTGACGAGTGCTAA

Gene: BRYFOR_01706: Heat shock protein Hsp20

Site:
position = -161
score = 7.2389
sequence = TTAGCACTCACTCTTGACGAGTGCTAA

Gene: BRYFOR_02574: Heat shock protein Hsp20
*
Clostridiales bacterium 1_7_47_FAA

Site:
position = -100
score = 7.24753
sequence = TTAGCACTCACCTCTTGACAGTGCTAA

Gene: Cbac1_010100004682: Heat shock protein Hsp20
*3
Clostridium bolteae ATCC BAA-613

Gene: CLOBOL_03753: Heat shock protein Hsp20

Site:
position = -75
score = 7.24753
sequence = TTAGCACTCACCTCTTGACAGTGCTAA

Gene: CLOBOL_03574: Heat shock protein Hsp20

Site:
position = -167
score = 6.14582
sequence = TTAGCACTCGACTCTTGACTTTGCTAA

Gene: CLOBOL_03752: Heat shock protein Hsp20
*
Clostridium nexile DSM 1787

Site:
position = -136
score = 7.24753
sequence = TTAGCACTCACCTCTTGACAGTGCTAA

Gene: CLONEX_03691: Heat shock protein Hsp20
*2
Clostridium scindens ATCC 35704

Site:
position = -100
score = 7.27858
sequence = TTAGCACTCAATACTTGACAGTGCTAA

Gene: CLOSCI_04021: Heat shock protein Hsp20

Site:
position = -97
score = 7.24058
sequence = TTAGCACTCATCTATTGACAGTGCTAA

Gene: CLOSCI_02851: Heat shock protein Hsp20
*2
Dorea formicigenerans ATCC 27755

Site:
position = -180
score = 7.24753
sequence = TTAGCACTCACCTCTTGACAGTGCTAA

Gene: DORFOR_00449: Heat shock protein Hsp20

Gene: DORFOR_00448: Heat shock protein Hsp20
*4
Dorea longicatena DSM 13814

Site:
position = -163
score = 7.43782
sequence = TTAGCACTCACTATTGACGAGTGCTAA

Gene: DORLON_00596: Heat shock protein Hsp20

Gene: DORLON_00595: Heat shock protein Hsp20

Site:
position = -207
score = 7.26776
sequence = TTAGCACTCACCTATTGACAGTGCTAA

Gene: DORLON_02781: Heat shock protein Hsp20

Site:
position = -184
score = 7.29371
sequence = TTAGCACTCACCTCTAGACAGTGCTAA

Gene: DORLON_02510: Heat shock protein Hsp20
*
Eubacterium eligens ATCC 27750

Site:
position = -178
score = 7.08138
sequence = TTAGCACTCACCCCTTGACAGTGCTAA

Gene: EUBELI_20272: Heat shock protein Hsp20
*4
Eubacterium rectale ATCC 33656

Site:
position = -204
score = 7.34937
sequence = TTAGCACTCGCTATTGACGAGTGCTAA

Gene: EUBREC_3351: Heat shock protein Hsp20

Site:
position = -157
score = 7.41903
sequence = TTAGCACTCTCTATTGACGAGTGCTAA

Gene: EUBREC_3394: Heat shock protein Hsp20

Site:
position = -157
score = 7.34937
sequence = TTAGCACTCGCTATTGACGAGTGCTAA

Gene: EUBREC_3358: Heat shock protein Hsp20

Site:
position = -109
score = 7.34937
sequence = TTAGCACTCGCTATTGACGAGTGCTAA

Gene: EUBREC_2855: Heat shock protein Hsp20
*
Roseburia intestinalis L1-82

Site:
position = -180
score = 6.76181
sequence = TTAGCACTCACCTCTTGACAGCGCTAA

Gene: ROSINTL182_00166: Heat shock protein Hsp20
*
Ruminococcus gnavus ATCC 29149

Site:
position = -150
score = 6.83352
sequence = TTAGCACTCACCACTTGACAGTGCCAA

Gene: RUMGNA_00923: Heat shock protein Hsp20
*
Ruminococcus lactaris ATCC 29176

Site:
position = -196
score = 6.74987
sequence = TTGGCACTCAACACTTTACAGTGCTAA

Gene: RUMLAC_01519: Heat shock protein Hsp20
Heat shock protein Hsp20
dnaJ2
 
Bacteroides pectinophilus ATCC 43243
 
Blautia hansenii DSM 20583
 
Bryantella formatexigens DSM 14469
 
Clostridiales bacterium 1_7_47_FAA
 
Clostridium bolteae ATCC BAA-613
 
Clostridium nexile DSM 1787

Gene: CLONEX_03690: Chaperone protein DnaJ
 
Clostridium scindens ATCC 35704
 
Dorea formicigenerans ATCC 27755

Gene: DORFOR_02225: Chaperone protein DnaJ
 
Dorea longicatena DSM 13814

Gene: DORLON_02780: Chaperone protein DnaJ
 
Eubacterium eligens ATCC 27750
 
Eubacterium rectale ATCC 33656

Gene: EUBREC_2854: Chaperone protein DnaJ
 
Roseburia intestinalis L1-82

Gene: ROSINTL182_01846: Chaperone protein DnaJ
 
Ruminococcus gnavus ATCC 29149

Gene: RUMGNA_00924: Chaperone protein DnaJ
 
Ruminococcus lactaris ATCC 29176

Gene: RUMLAC_00597: Chaperone protein DnaJ
Chaperone protein DnaJ
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD