Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog AguR - Lactobacillaceae

Properties
Regulator type: Transcription factor
Regulator family: RpiR
Regulation mode:
Biological process: Agmatine utilization
Effector:
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 3 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Lactobacillus acidophilus NCFM
Lactobacillus brevis ATCC 367 6 1
Lactobacillus casei ATCC 334
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
Lactobacillus fermentum IFO 3956
Lactobacillus helveticus DPC 4571
Lactobacillus johnsonii NCC 533
Lactobacillus plantarum WCFS1
Lactobacillus reuteri JCM 1112
Lactobacillus rhamnosus GG
Lactobacillus sakei subsp. sakei 23K 7 1
Lactobacillus salivarius subsp. salivarius UCC118
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
Oenococcus oeni PSU-1
Pediococcus pentosaceus ATCC 25745 6 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
ptcA
 
Lactobacillus acidophilus NCFM
*
Lactobacillus brevis ATCC 367

Site:
position = -157
score = 5.61908
sequence = GAATGAAACATGTGTCACCA

Gene: LVIS_2210: Putrescine carbamoyltransferase (EC 2.1.3.6)
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
*
Lactobacillus sakei subsp. sakei 23K

Site:
position = -121
score = 4.80175
sequence = AAATGGAACAAAATACACAT

Gene: LSA0067: Putrescine carbamoyltransferase (EC 2.1.3.6)
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
*
Pediococcus pentosaceus ATCC 25745

Site:
position = -145
score = 6.23813
sequence = AAATGAAACATGTTTCATGA

Gene: PEPE_0189: Putrescine carbamoyltransferase (EC 2.1.3.6)
Putrescine carbamoyltransferase (EC 2.1.3.6)
aguD
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367

Gene: LVIS_2209: Agmatine/putrescine antiporter, associated with agmatine catabolism
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
 2
Lactobacillus sakei subsp. sakei 23K

Gene: LSA0068: Agmatine/putrescine antiporter, associated with agmatine catabolism

Gene: LSA0069: Agmatine/putrescine antiporter, associated with agmatine catabolism
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_0190: Agmatine/putrescine antiporter, associated with agmatine catabolism
Agmatine/putrescine antiporter, associated with agmatine catabolism
aguA1
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367

Gene: LVIS_2208: Agmatine deiminase (EC 3.5.3.12)
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K

Gene: LSA0070: Agmatine deiminase (EC 3.5.3.12)
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_0191: Agmatine deiminase (EC 3.5.3.12)
Agmatine deiminase (EC 3.5.3.12)
aguC
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367

Gene: LVIS_2207: Carbamate kinase (EC 2.7.2.2)
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K

Gene: LSA0071: Carbamate kinase (EC 2.7.2.2)
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_0192: Carbamate kinase (EC 2.7.2.2)
Carbamate kinase (EC 2.7.2.2)
aguA2
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367

Gene: LVIS_2206: Agmatine deiminase (EC 3.5.3.12)
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K

Gene: LSA0072: Agmatine deiminase (EC 3.5.3.12)
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_0193: Agmatine deiminase (EC 3.5.3.12)
Agmatine deiminase (EC 3.5.3.12)
aguR
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367

Gene: LVIS_2205: Predicted agmatine utilization transcriptional regulator AguR, RpiR family
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K

Gene: LSA0073: Predicted agmatine utilization transcriptional regulator AguR, RpiR family
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_0194: Predicted agmatine utilization transcriptional regulator AguR, RpiR family
Predicted agmatine utilization transcriptional regulator AguR, RpiR family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD