Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog FlpA - Lactobacillaceae

Properties
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: activator (repressor)
Biological process: Heavy metal resistance
Effector: Oxygen
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 32 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Lactobacillus acidophilus NCFM 4 2
Lactobacillus brevis ATCC 367
Lactobacillus casei ATCC 334 4 2
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 2 1
Lactobacillus fermentum IFO 3956 7 4
Lactobacillus helveticus DPC 4571
Lactobacillus johnsonii NCC 533 2 2
Lactobacillus plantarum WCFS1 5 4
Lactobacillus reuteri JCM 1112 3 2
Lactobacillus rhamnosus GG 2 2
Lactobacillus sakei subsp. sakei 23K 4 2
Lactobacillus salivarius subsp. salivarius UCC118 4 4
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 4 2
Oenococcus oeni PSU-1 3 2
Pediococcus pentosaceus ATCC 25745 4 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
copZ
*
Lactobacillus acidophilus NCFM

Site:
position = -81
score = 5.97169
sequence = AAATTGACGATCATCAAGTT

Gene: LBA0542: Copper chaperone
 
Lactobacillus brevis ATCC 367

Gene: LVIS_0693: Copper chaperone
*
Lactobacillus casei ATCC 334

Site:
position = -76
score = 5.3869
sequence = AACTTGACGACGATCAAGGA

Gene: LSEI_0071: Copper chaperone
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Gene: LBUL_0428: Copper chaperone
*2
Lactobacillus fermentum IFO 3956

Site:
position = -68
score = 5.07974
sequence = AAGTTGATGAGGATCAATTA

Gene: LAF_1701: Copper chaperone

Site:
position = -91
score = 4.76427
sequence = AAGTTGATAGAAAACAATTT

Gene: LAF_1466: Copper chaperone
 
Lactobacillus helveticus DPC 4571
*
Lactobacillus johnsonii NCC 533

Site:
position = -82
score = 5.97169
sequence = AAATTGACGATCATCAAGTT

Gene: LJ1695: Copper chaperone
*
Lactobacillus plantarum WCFS1

Site:
position = -75
score = 5.95664
sequence = TTCTTGACGGCCGTCAAGTT

Gene: lp_3442: Copper chaperone
*
Lactobacillus reuteri JCM 1112

Site:
position = -69
score = 5.67517
sequence = AAATTGATGATAATCAATTT

Gene: LAR_1340: Copper chaperone
*
Lactobacillus rhamnosus GG

Site:
position = -76
score = 6.0267
sequence = AACTTGACGGCCATCAAGGT

Gene: LGG_00083: Copper chaperone
*
Lactobacillus sakei subsp. sakei 23K

Site:
position = -79
score = 6.09395
sequence = AACTTGATGGCGATCAATTT

Gene: LSA1783: Copper chaperone
*
Lactobacillus salivarius subsp. salivarius UCC118

Site:
position = -129
score = 5.89238
sequence = AACTTGATATGCGTCAATTT

Gene: LSL_1784: Copper chaperone
*
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Site:
position = -66
score = 5.17102
sequence = TAATTGATCTATATCAAGTA

Gene: LEUM_A04: Copper chaperone
*
Oenococcus oeni PSU-1

Site:
position = -126
score = 5.95664
sequence = TTCTTGACGGCCGTCAAGTT

Gene: OEOE_0354: Copper chaperone
*
Pediococcus pentosaceus ATCC 25745

Site:
position = -75
score = 5.71126
sequence = AAATTGACCTACGTCAATTT

Gene: PEPE_0409: Copper chaperone
Copper chaperone
LAF_1465
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956

Gene: LAF_1465: Hypothetical protein
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
Hypothetical protein
flpA
 2
Lactobacillus acidophilus NCFM

Gene: LBA1969: Heavy metal resistance transcriptional regulator FlpA, Crp family

Gene: LBA0544: Heavy metal resistance transcriptional regulator FlpA, Crp family
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334

Gene: LSEI_0073: Heavy metal resistance transcriptional regulator FlpA, Crp family
 2
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Gene: LBUL_0159: Heavy metal resistance transcriptional regulator FlpA, Crp family

Gene: LBUL_0430: Heavy metal resistance transcriptional regulator FlpA, Crp family
 2
Lactobacillus fermentum IFO 3956

Gene: LAF_1699: Heavy metal resistance transcriptional regulator FlpA, Crp family

Gene: LAF_1464: Heavy metal resistance transcriptional regulator FlpA, Crp family
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533

Gene: LJ1693: Heavy metal resistance transcriptional regulator FlpA, Crp family
*2
Lactobacillus plantarum WCFS1

Site:
position = -31
score = 5.27792
sequence = AAATTGACATAAATCAAGAA

Gene: lp_1442: Heavy metal resistance transcriptional regulator FlpA, Crp family

Site:
position = -142
score = 5.95664
sequence = AACTTGACGGCCGTCAAGAA

Gene: lp_3444: Heavy metal resistance transcriptional regulator FlpA, Crp family
 2
Lactobacillus reuteri JCM 1112

Gene: LAR_0962: Heavy metal resistance transcriptional regulator FlpA, Crp family

Gene: LAR_1338: Heavy metal resistance transcriptional regulator FlpA, Crp family
 
Lactobacillus rhamnosus GG

Gene: LGG_00085: Heavy metal resistance transcriptional regulator FlpA, Crp family
 
Lactobacillus sakei subsp. sakei 23K

Gene: LSA1781: Heavy metal resistance transcriptional regulator FlpA, Crp family
*
Lactobacillus salivarius subsp. salivarius UCC118

Site:
position = -89
score = 5.61331
sequence = TTCTTGATGTGCATCAATTT

Gene: LSL_1782: Heavy metal resistance transcriptional regulator FlpA, Crp family
 2
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Gene: LEUM_A06: Heavy metal resistance transcriptional regulator FlpA, Crp family

Gene: LEUM_2066: Heavy metal resistance transcriptional regulator FlpA, Crp family
*
Oenococcus oeni PSU-1

Site:
position = -142
score = 5.95664
sequence = AACTTGACGGCCGTCAAGAA

Gene: OEOE_0355: Heavy metal resistance transcriptional regulator FlpA, Crp family
*
Pediococcus pentosaceus ATCC 25745

Site:
position = -74
score = 5.71126
sequence = AAATTGACGTAGGTCAATTT

Gene: PEPE_0408: Heavy metal resistance transcriptional regulator FlpA, Crp family
Heavy metal resistance transcriptional regulator FlpA, Crp family
dps
 
Lactobacillus acidophilus NCFM

Gene: LBA0543: Non-specific DNA-binding protein Dps / Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)
 
Lactobacillus brevis ATCC 367

Gene: LVIS_0692: Non-specific DNA-binding protein Dps / Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)
 
Lactobacillus casei ATCC 334

Gene: LSEI_0072: Non-specific DNA-binding protein Dps / Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
*
Lactobacillus fermentum IFO 3956

Site:
position = -298
score = 5.07974
sequence = AAGTTGATGAGGATCAATTA

Gene: LAF_1700: Non-specific DNA-binding protein Dps / Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1

Gene: lp_3441: Non-specific DNA-binding protein Dps / Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)
*
Lactobacillus reuteri JCM 1112

Site:
position = -298
score = 5.67517
sequence = AAATTGATGATAATCAATTT

Gene: LAR_1339: Non-specific DNA-binding protein Dps / Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)
 
Lactobacillus rhamnosus GG

Gene: LGG_00084: Non-specific DNA-binding protein Dps / Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)
 
Lactobacillus sakei subsp. sakei 23K

Gene: LSA1782: Non-specific DNA-binding protein Dps / Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)
*
Lactobacillus salivarius subsp. salivarius UCC118

Site:
position = -118
score = 5.54699
sequence = TTCTTGATGAGCGTCAATTT

Gene: LSL_1781: Non-specific DNA-binding protein Dps / Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Gene: LEUM_A05: Non-specific DNA-binding protein Dps / Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)
 
Oenococcus oeni PSU-1

Gene: OEOE_0353: Non-specific DNA-binding protein Dps / Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_0410: Non-specific DNA-binding protein Dps / Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)
Non-specific DNA-binding protein Dps / Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)
cadA
*
Lactobacillus acidophilus NCFM

Site:
position = -75
score = 5.38156
sequence = ATCTTGATAACAGTCAAGTC

Gene: LBA0541: Lead, cadmium, zinc and mercury transporting ATPase (EC:3.6.3.-)
 
Lactobacillus brevis ATCC 367

Gene: LVIS_0691: Lead, cadmium, zinc and mercury transporting ATPase (EC:3.6.3.-)
*
Lactobacillus casei ATCC 334

Site:
position = -68
score = 4.83265
sequence = AAGTTGATCACCGTCAAGGC

Gene: LSEI_0070: Lead, cadmium, zinc and mercury transporting ATPase (EC:3.6.3.-)
*
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Site:
position = -77
score = 5.25894
sequence = ATCTTGATAGAAATCAATTG

Gene: LBUL_0427: Lead, cadmium, zinc and mercury transporting ATPase (EC:3.6.3.-)
*
Lactobacillus fermentum IFO 3956

Site:
position = -69
score = 5.20176
sequence = CTCTTGATTCCGATCAATTT

Gene: LAF_1702: Lead, cadmium, zinc and mercury transporting ATPase (EC:3.6.3.-)
 
Lactobacillus helveticus DPC 4571
*
Lactobacillus johnsonii NCC 533

Site:
position = -75
score = 5.22225
sequence = ATCTTGATAATAGTCAAGTC

Gene: LJ1696: Lead, cadmium, zinc and mercury transporting ATPase (EC:3.6.3.-)
*
Lactobacillus plantarum WCFS1

Site:
position = -78
score = 6.14076
sequence = AACTTGACGCCTATCAAGTT

Gene: lp_3435: Lead, cadmium, zinc and mercury transporting ATPase (EC:3.6.3.-)
 
Lactobacillus reuteri JCM 1112
*
Lactobacillus rhamnosus GG

Site:
position = -68
score = 5.34234
sequence = AAATTGATCCCGGTCAAGGT

Gene: LGG_00082: Lead, cadmium, zinc and mercury transporting ATPase (EC:3.6.3.-)
*
Lactobacillus sakei subsp. sakei 23K

Site:
position = -75
score = 6.27702
sequence = AACTTGATGGCTATCAAGTT

Gene: LSA1784: Lead, cadmium, zinc and mercury transporting ATPase (EC:3.6.3.-)
*
Lactobacillus salivarius subsp. salivarius UCC118

Site:
position = -210
score = 5.61847
sequence = AACTTGATAGCCATAAATTT

Site:
position = -88
score = 5.7445
sequence = AACTTGATGTCAGTCAATTA

Gene: LSL_1786: Lead, cadmium, zinc and mercury transporting ATPase (EC:3.6.3.-)
*
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Site:
position = -76
score = 6.32516
sequence = AACTTGATGGACGTCAAGTT

Gene: LEUM_A03: Lead, cadmium, zinc and mercury transporting ATPase (EC:3.6.3.-)
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_0411: Lead, cadmium, zinc and mercury transporting ATPase (EC:3.6.3.-)
Lead, cadmium, zinc and mercury transporting ATPase (EC:3.6.3.-)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD