Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CzcR1 - Lactobacillaceae

Properties
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Zinc resistance; Cobalt resistance; Cadmium resistance
Effector:
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 10 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Lactobacillus acidophilus NCFM
Lactobacillus brevis ATCC 367
Lactobacillus casei ATCC 334
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 2 2
Lactobacillus fermentum IFO 3956
Lactobacillus helveticus DPC 4571
Lactobacillus johnsonii NCC 533 2 2
Lactobacillus plantarum WCFS1
Lactobacillus reuteri JCM 1112 2 1
Lactobacillus rhamnosus GG
Lactobacillus sakei subsp. sakei 23K
Lactobacillus salivarius subsp. salivarius UCC118
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
Oenococcus oeni PSU-1
Pediococcus pentosaceus ATCC 25745
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
czcD
 
Lactobacillus acidophilus NCFM

Gene: LBA0340: Cobalt-zinc-cadmium resistance protein CzcD
 
Lactobacillus brevis ATCC 367

Gene: LVIS_1719: Cobalt-zinc-cadmium resistance protein CzcD
 
Lactobacillus casei ATCC 334
*
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Site:
position = -76
score = 6.39097
sequence = ATATACCAAAAATGATATAT

Site:
position = -113
score = 4.97513
sequence = GTATATTATTTTTGTAATAT

Gene: LBUL_1220: Cobalt-zinc-cadmium resistance protein CzcD
 
Lactobacillus fermentum IFO 3956

Gene: LAF_1544: Cobalt-zinc-cadmium resistance protein CzcD
 
Lactobacillus helveticus DPC 4571

Gene: lhv_0353: Cobalt-zinc-cadmium resistance protein CzcD
*
Lactobacillus johnsonii NCC 533

Site:
position = -35
score = 6.27815
sequence = GTATACCAAATTCGATATAT

Site:
position = -72
score = 6.12555
sequence = ATATATCAAAAATGGAATAT

Gene: LJ0377: Cobalt-zinc-cadmium resistance protein CzcD
 
Lactobacillus plantarum WCFS1
 
Lactobacillus reuteri JCM 1112

Gene: LAR_1416: Cobalt-zinc-cadmium resistance protein CzcD
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
Cobalt-zinc-cadmium resistance protein CzcD
 
CRON 2.
cadD1
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367

Gene: LVIS_0221: Predicted permease, cadmium resistance protein
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956

Gene: LAF_0146: Predicted permease, cadmium resistance protein
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1

Gene: lp_2998: Predicted permease, cadmium resistance protein
*
Lactobacillus reuteri JCM 1112

Site:
position = -60
score = 6.51911
sequence = ATATATCAAATTCGATATAT

Site:
position = -33
score = 6.32256
sequence = GTATATCGAATTTGATATAT

Gene: LAR_1705: Predicted permease, cadmium resistance protein
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
Predicted permease, cadmium resistance protein
czcR1
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334
*
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Site:
position = -88
score = 6.39097
sequence = ATATATCATTTTTGGTATAT

Site:
position = -51
score = 4.97513
sequence = ATATTACAAAAATAATATAC

Gene: LBUL_1221: Cobalt-zinc-cadmium resistance transcriptional regulator CzcR1, ArsR family
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
*
Lactobacillus johnsonii NCC 533

Site:
position = -40
score = 6.12555
sequence = ATATTCCATTTTTGATATAT

Site:
position = -77
score = 6.27815
sequence = ATATATCGAATTTGGTATAC

Gene: LJ0376: Cobalt-zinc-cadmium resistance transcriptional regulator CzcR1, ArsR family
 
Lactobacillus plantarum WCFS1
 
Lactobacillus reuteri JCM 1112

Gene: LAR_1706: Cobalt-zinc-cadmium resistance transcriptional regulator CzcR1, ArsR family
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
Cobalt-zinc-cadmium resistance transcriptional regulator CzcR1, ArsR family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD