Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog TreR (RgrA) - Streptococcaceae

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode:
Biological process: Trehalose utilization
Effector: Trehalose-6-phosphate
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Lactococcus lactis subsp. cremoris SK11 5 2
Lactococcus lactis subsp. lactis Il1403 5 2
Streptococcus agalactiae 2603V/R
Streptococcus dysgalactiae subsp. equisimilis GGS_124
Streptococcus equi subsp. zooepidemicus MGCS10565
Streptococcus gallolyticus UCN34
Streptococcus gordonii str. Challis substr. CH1
Streptococcus mitis B6
Streptococcus mutans UA159
Streptococcus pneumoniae TIGR4
Streptococcus pyogenes M1 GAS
Streptococcus sanguinis SK36
Streptococcus suis 05ZYH33
Streptococcus thermophilus CNRZ1066
Streptococcus uberis 0140J
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
treP
*2
Lactococcus lactis subsp. cremoris SK11

Site:
position = -39
score = 7.22986
sequence = TTAACTTGTACGTACAACTGCA

Gene: LACR_0481: Trehalose-specific PTS, IIBC component (EC 2.7.1.69)

Gene: LACR_0482: Trehalose-specific PTS, IIBC component (EC 2.7.1.69)
*2
Lactococcus lactis subsp. lactis Il1403

Site:
position = -39
score = 7.39455
sequence = TTAACTTGTACGTACAACTTCA

Gene: L37338: Trehalose-specific PTS, IIBC component (EC 2.7.1.69)

Gene: L37906: Trehalose-specific PTS, IIBC component (EC 2.7.1.69)
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Trehalose-specific PTS, IIBC component (EC 2.7.1.69)
trePP
 
Lactococcus lactis subsp. cremoris SK11

Gene: LACR_0483: Trehalose 6-phosphate phosphorylase (EC 2.4.1.216)
 
Lactococcus lactis subsp. lactis Il1403

Gene: L39593: Trehalose 6-phosphate phosphorylase (EC 2.4.1.216)
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Trehalose 6-phosphate phosphorylase (EC 2.4.1.216)
pgmB
 
Lactococcus lactis subsp. cremoris SK11

Gene: LACR_0484: Beta-phosphoglucomutase (EC 5.4.2.6)
 
Lactococcus lactis subsp. lactis Il1403

Gene: L0001: Beta-phosphoglucomutase (EC 5.4.2.6)
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Beta-phosphoglucomutase (EC 5.4.2.6)
 
CRON 2.
treR
*
Lactococcus lactis subsp. cremoris SK11

Site:
position = -108
score = 7.22986
sequence = TGCAGTTGTACGTACAAGTTAA

Gene: LACR_0480: Trehalose utilization transcriptional regulator RgrA, GntR family
*
Lactococcus lactis subsp. lactis Il1403

Site:
position = -93
score = 7.39455
sequence = TGAAGTTGTACGTACAAGTTAA

Gene: L0150: Trehalose utilization transcriptional regulator RgrA, GntR family
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Trehalose utilization transcriptional regulator RgrA, GntR family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD