Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog NrfR - Bacteroidaceae

Properties
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: activator
Biological process: Nitrate and nitrite respiration
Effector: Nitrite
Phylum: Bacteroidetes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 6 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bacteroides cellulosilyticus DSM 14838 3 1
Bacteroides coprophilus DSM 18228
Bacteroides dorei DSM 17855
Bacteroides eggerthii DSM 20697
Bacteroides fragilis NCTC 9343 6 1
Bacteroides ovatus ATCC 8483 5 1
Bacteroides plebeius DSM 17135 5 1
Bacteroides stercoris ATCC 43183
Bacteroides thetaiotaomicron VPI-5482 5 1
Bacteroides uniformis ATCC 8492 5 1
Bacteroides vulgatus ATCC 8482
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
nrfH
*
Bacteroides cellulosilyticus DSM 14838

Site:
position = -65
score = 6.58022
sequence = GATGTAATCATTATTACACT

Gene: BACCELL_02840: Cytochrome c nitrite reductase, small subunit NrfH
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
*
Bacteroides fragilis NCTC 9343

Site:
position = -73
score = 6.13525
sequence = AATGTAATCTGGATTACATC

Gene: BF0360: Cytochrome c nitrite reductase, small subunit NrfH
*
Bacteroides ovatus ATCC 8483

Site:
position = -65
score = 6.42757
sequence = GGTGTAATAGATATTACACC

Gene: BACOVA_00831: Cytochrome c nitrite reductase, small subunit NrfH
*
Bacteroides plebeius DSM 17135

Site:
position = 27
score = 6.01401
sequence = GGTGTCATATTTATTACACC

Gene: BACPLE_01440: Cytochrome c nitrite reductase, small subunit NrfH
 
Bacteroides stercoris ATCC 43183
*
Bacteroides thetaiotaomicron VPI-5482

Site:
position = -66
score = 6.57031
sequence = GGTGTAATAGTTATTACACC

Gene: BT1418: Cytochrome c nitrite reductase, small subunit NrfH
*
Bacteroides uniformis ATCC 8492

Site:
position = -64
score = 6.5138
sequence = AATGTAATCATGATTACACT

Gene: BACUNI_04432: Cytochrome c nitrite reductase, small subunit NrfH
 
Bacteroides vulgatus ATCC 8482
Cytochrome c nitrite reductase, small subunit NrfH
nrfA
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_02841: Cytochrome c552 precursor (EC 1.7.2.2)
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343

Gene: BF0361: Cytochrome c552 precursor (EC 1.7.2.2)
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_00830: Cytochrome c552 precursor (EC 1.7.2.2)
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_01441: Cytochrome c552 precursor (EC 1.7.2.2)
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT1417: Cytochrome c552 precursor (EC 1.7.2.2)
 
Bacteroides uniformis ATCC 8492

Gene: BACUNI_04431: Cytochrome c552 precursor (EC 1.7.2.2)
 
Bacteroides vulgatus ATCC 8482
Cytochrome c552 precursor (EC 1.7.2.2)
nrfI
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_02842: Cytochrome c biogenesis protein
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343

Gene: BF0362: Cytochrome c biogenesis protein
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_00829: Cytochrome c biogenesis protein
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_01442: Cytochrome c biogenesis protein
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT1416: Cytochrome c biogenesis protein
 
Bacteroides uniformis ATCC 8492

Gene: BACUNI_04430: Cytochrome c biogenesis protein
 
Bacteroides vulgatus ATCC 8482
Cytochrome c biogenesis protein
nrfE
 2
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_05716: Cytochrome c biogenesis protein

Gene: BACCELL_02843: Cytochrome c biogenesis protein
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343

Gene: BF0363: Cytochrome c biogenesis protein
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_00828: Cytochrome c biogenesis protein
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_01443: Cytochrome c biogenesis protein
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT1415: Cytochrome c biogenesis protein
 
Bacteroides uniformis ATCC 8492

Gene: BACUNI_04429: Cytochrome c biogenesis protein
 
Bacteroides vulgatus ATCC 8482
Cytochrome c biogenesis protein
nrfP
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_02844: Predicted porin, associated with nitrate respiration
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343

Gene: BF0364: Predicted porin, associated with nitrate respiration
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_00827: Predicted porin, associated with nitrate respiration
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_01444: Predicted porin, associated with nitrate respiration
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT1414: Predicted porin, associated with nitrate respiration
 
Bacteroides uniformis ATCC 8492

Gene: BACUNI_04428: Predicted porin, associated with nitrate respiration
 
Bacteroides vulgatus ATCC 8482
Predicted porin, associated with nitrate respiration
nrfR
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_02845: Predicted transcriptional regulator of nitrite reductase, Crp family
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343

Gene: BF0365: Predicted transcriptional regulator of nitrite reductase, Crp family
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_00819: Predicted transcriptional regulator of nitrite reductase, Crp family
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_01445: Predicted transcriptional regulator of nitrite reductase, Crp family
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT1413: Predicted transcriptional regulator of nitrite reductase, Crp family
 
Bacteroides uniformis ATCC 8492

Gene: BACUNI_04427: Predicted transcriptional regulator of nitrite reductase, Crp family
 
Bacteroides vulgatus ATCC 8482
Predicted transcriptional regulator of nitrite reductase, Crp family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD