Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog SusR2 - Bacteroidaceae

Properties
Regulator type: Transcription factor
Regulator family: [Other]
Regulation mode: repressor
Biological process: Starch utilization
Effector:
Phylum: Bacteroidetes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 10 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bacteroides cellulosilyticus DSM 14838 2 1
Bacteroides coprophilus DSM 18228
Bacteroides dorei DSM 17855
Bacteroides eggerthii DSM 20697
Bacteroides fragilis NCTC 9343
Bacteroides ovatus ATCC 8483 5 1
Bacteroides plebeius DSM 17135
Bacteroides stercoris ATCC 43183 6 1
Bacteroides thetaiotaomicron VPI-5482 5 1
Bacteroides uniformis ATCC 8492 7 1
Bacteroides vulgatus ATCC 8482
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
susC2
*
Bacteroides cellulosilyticus DSM 14838

Site:
position = -208
score = 5.66621
sequence = ATTTTTACTACTTTTTTGGA

Site:
position = -131
score = 6.16593
sequence = AAAACTACTACTTTTTCACT

Gene: BACCELL_04952: SusC2, outer membrane protein involved in starch binding
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
*
Bacteroides ovatus ATCC 8483

Site:
position = -204
score = 6.58591
sequence = AAAATCACTACTTTTTTAGT

Site:
position = -127
score = 5.94747
sequence = TAAATCACTATATTTTTGCT

Gene: BACOVA_02787: SusC2, outer membrane protein involved in starch binding
 
Bacteroides plebeius DSM 17135
*
Bacteroides stercoris ATCC 43183

Site:
position = -273
score = 6.30187
sequence = TAAATCACTACTTTTTCACT

Site:
position = -350
score = 6.1125
sequence = ATTTTTACTACTTTTTTAGT

Gene: BACSTE_01926: SusC2, outer membrane protein involved in starch binding
*
Bacteroides thetaiotaomicron VPI-5482

Site:
position = -186
score = 6.14442
sequence = AAATCCACTACTTTTTTAGC

Site:
position = -109
score = 5.8819
sequence = TAAACCACTATATTTTTGCT

Gene: BT3090: SusC2, outer membrane protein involved in starch binding
*
Bacteroides uniformis ATCC 8492

Site:
position = -206
score = 6.24845
sequence = ATTTTCACTACTTTTTTAGT

Site:
position = -129
score = 6.45477
sequence = TAAACCACTACTTTTTTACT

Gene: BACUNI_01942: SusC2, outer membrane protein involved in starch binding
 
Bacteroides vulgatus ATCC 8482
SusC2, outer membrane protein involved in starch binding
susD2
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_04951: SusD2, outer membrane protein involved in starch binding
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_02786: SusD2, outer membrane protein involved in starch binding
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183

Gene: BACSTE_01925: SusD2, outer membrane protein involved in starch binding
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT3089: SusD2, outer membrane protein involved in starch binding
 2
Bacteroides uniformis ATCC 8492

Gene: BACUNI_01943: SusD2, outer membrane protein involved in starch binding

Gene: BACUNI_01944: SusD2, outer membrane protein involved in starch binding
 
Bacteroides vulgatus ATCC 8482
SusD2, outer membrane protein involved in starch binding
susE2
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_04941: Outer membrane protein SusE2
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_02785: Outer membrane protein SusE2
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183

Gene: BACSTE_01924: Outer membrane protein SusE2
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT3088: Outer membrane protein SusE2
 
Bacteroides uniformis ATCC 8492

Gene: BACUNI_01945: Outer membrane protein SusE2
 
Bacteroides vulgatus ATCC 8482
Outer membrane protein SusE2
dexA
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_04940: Dextranase (EC 3.2.1.11)
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_02784: Dextranase (EC 3.2.1.11)
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT3087: Dextranase (EC 3.2.1.11)
 
Bacteroides uniformis ATCC 8492

Gene: BACUNI_01946: Dextranase (EC 3.2.1.11)
 
Bacteroides vulgatus ATCC 8482
Dextranase (EC 3.2.1.11)
gaa
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_04939: Glucan 1,3-alpha-glucosidase (EC 3.2.1.84)
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_02783: Glucan 1,3-alpha-glucosidase (EC 3.2.1.84)
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183

Gene: BACSTE_01922: Glucan 1,3-alpha-glucosidase (EC 3.2.1.84)
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT3086: Glucan 1,3-alpha-glucosidase (EC 3.2.1.84)
 
Bacteroides uniformis ATCC 8492

Gene: BACUNI_01947: Glucan 1,3-alpha-glucosidase (EC 3.2.1.84)
 
Bacteroides vulgatus ATCC 8482
Glucan 1,3-alpha-glucosidase (EC 3.2.1.84)
susB2
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_04938: Alpha-glucosidase SusB2 (EC 3.2.1.20)
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183

Gene: BACSTE_01921: Alpha-glucosidase SusB2 (EC 3.2.1.20)
 
Bacteroides thetaiotaomicron VPI-5482
 
Bacteroides uniformis ATCC 8492

Gene: BACUNI_01948: Alpha-glucosidase SusB2 (EC 3.2.1.20)
 
Bacteroides vulgatus ATCC 8482
Alpha-glucosidase SusB2 (EC 3.2.1.20)
agaL
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183

Gene: BACSTE_01923: Alpha-galactosidase
 
Bacteroides thetaiotaomicron VPI-5482
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
Alpha-galactosidase
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD