Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog AgaR - Streptococcaceae

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: N-acetylgalactosamine utilization
Effector: N-acetylgalactosamine
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 16 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Lactococcus lactis subsp. cremoris SK11
Lactococcus lactis subsp. lactis Il1403
Streptococcus agalactiae 2603V/R
Streptococcus dysgalactiae subsp. equisimilis GGS_124 6 2
Streptococcus equi subsp. zooepidemicus MGCS10565 6 2
Streptococcus gallolyticus UCN34
Streptococcus gordonii str. Challis substr. CH1 6 2
Streptococcus mitis B6 6 2
Streptococcus mutans UA159
Streptococcus pneumoniae TIGR4 6 2
Streptococcus pyogenes M1 GAS
Streptococcus sanguinis SK36 6 2
Streptococcus suis 05ZYH33 6 2
Streptococcus thermophilus CNRZ1066
Streptococcus uberis 0140J 6 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
bgaC
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
*
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Site:
position = -89
score = 5.31083
sequence = TTAGCTATTATAACAAAAAA

Gene: SDEG_0679: Beta-galactosidase (EC 3.2.1.23)
*
Streptococcus equi subsp. zooepidemicus MGCS10565

Site:
position = -116
score = 4.74258
sequence = AATACGATTATAGCAAAAAT

Gene: Sez_0741: Beta-galactosidase (EC 3.2.1.23)
 
Streptococcus gallolyticus UCN34
*
Streptococcus gordonii str. Challis substr. CH1

Site:
position = -67
score = 5.56188
sequence = AATGTTATTATATTAATTAA

Gene: SGO_0043: Beta-galactosidase (EC 3.2.1.23)
*
Streptococcus mitis B6

Site:
position = -56
score = 5.48484
sequence = ATATTTAATATATCAACAAA

Gene: smi_0079: Beta-galactosidase (EC 3.2.1.23)
 
Streptococcus mutans UA159
*
Streptococcus pneumoniae TIGR4

Site:
position = -56
score = 5.56325
sequence = ATAATTAATATAACAACAAA

Gene: SP_0060: Beta-galactosidase (EC 3.2.1.23)
 
Streptococcus pyogenes M1 GAS
*
Streptococcus sanguinis SK36

Site:
position = -61
score = 5.51401
sequence = AAATTTATTATATTAATATT

Gene: SSA_0053: Beta-galactosidase (EC 3.2.1.23)
*
Streptococcus suis 05ZYH33

Site:
position = -48
score = 4.90934
sequence = AGTGTTAGTATATTAATAGA

Gene: SSU05_0449: Beta-galactosidase (EC 3.2.1.23)
 
Streptococcus thermophilus CNRZ1066
*
Streptococcus uberis 0140J

Site:
position = -103
score = 5.09114
sequence = AGAACTATTATAACAGAAAT

Gene: SUB0042: Beta-galactosidase (EC 3.2.1.23)
Beta-galactosidase (EC 3.2.1.23)
gadV
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_0680: Predicted galactosamine disaccharide-specific PTS system, IIB component (EC 2.7.1.69)
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_0742: Predicted galactosamine disaccharide-specific PTS system, IIB component (EC 2.7.1.69)
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_0044: Predicted galactosamine disaccharide-specific PTS system, IIB component (EC 2.7.1.69)
 
Streptococcus mitis B6

Gene: smi_0080: Predicted galactosamine disaccharide-specific PTS system, IIB component (EC 2.7.1.69)
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4

Gene: SP_0061: Predicted galactosamine disaccharide-specific PTS system, IIB component (EC 2.7.1.69)
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36

Gene: SSA_0054: Predicted galactosamine disaccharide-specific PTS system, IIB component (EC 2.7.1.69)
 
Streptococcus suis 05ZYH33

Gene: SSU05_0450: Predicted galactosamine disaccharide-specific PTS system, IIB component (EC 2.7.1.69)
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J

Gene: SUB0043: Predicted galactosamine disaccharide-specific PTS system, IIB component (EC 2.7.1.69)
Predicted galactosamine disaccharide-specific PTS system, IIB component (EC 2.7.1.69)
gadW
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_0681: Predicted galactosamine disaccharide-specific PTS system, IIC component (EC 2.7.1.69)
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_0743: Predicted galactosamine disaccharide-specific PTS system, IIC component (EC 2.7.1.69)
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_0045: Predicted galactosamine disaccharide-specific PTS system, IIC component (EC 2.7.1.69)
 
Streptococcus mitis B6

Gene: smi_0081: Predicted galactosamine disaccharide-specific PTS system, IIC component (EC 2.7.1.69)
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4

Gene: SP_0062: Predicted galactosamine disaccharide-specific PTS system, IIC component (EC 2.7.1.69)
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36

Gene: SSA_0055: Predicted galactosamine disaccharide-specific PTS system, IIC component (EC 2.7.1.69)
 
Streptococcus suis 05ZYH33

Gene: SSU05_0451: Predicted galactosamine disaccharide-specific PTS system, IIC component (EC 2.7.1.69)
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J

Gene: SUB0044: Predicted galactosamine disaccharide-specific PTS system, IIC component (EC 2.7.1.69)
Predicted galactosamine disaccharide-specific PTS system, IIC component (EC 2.7.1.69)
gadE
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_0682: Predicted galactosamine disaccharide-specific PTS system, IID component (EC 2.7.1.69)
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_0744: Predicted galactosamine disaccharide-specific PTS system, IID component (EC 2.7.1.69)
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_0046: Predicted galactosamine disaccharide-specific PTS system, IID component (EC 2.7.1.69)
 
Streptococcus mitis B6

Gene: smi_0082: Predicted galactosamine disaccharide-specific PTS system, IID component (EC 2.7.1.69)
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4

Gene: SP_0063: Predicted galactosamine disaccharide-specific PTS system, IID component (EC 2.7.1.69)
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36

Gene: SSA_0056: Predicted galactosamine disaccharide-specific PTS system, IID component (EC 2.7.1.69)
 
Streptococcus suis 05ZYH33

Gene: SSU05_0452: Predicted galactosamine disaccharide-specific PTS system, IID component (EC 2.7.1.69)
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J

Gene: SUB0045: Predicted galactosamine disaccharide-specific PTS system, IID component (EC 2.7.1.69)
Predicted galactosamine disaccharide-specific PTS system, IID component (EC 2.7.1.69)
gadF
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_0683: Predicted galactosamine disaccharide-specific PTS system, IIA component (EC 2.7.1.69)
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_0745: Predicted galactosamine disaccharide-specific PTS system, IIA component (EC 2.7.1.69)
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_0047: Predicted galactosamine disaccharide-specific PTS system, IIA component (EC 2.7.1.69)
 
Streptococcus mitis B6

Gene: smi_0083: Predicted galactosamine disaccharide-specific PTS system, IIA component (EC 2.7.1.69)
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4

Gene: SP_0064: Predicted galactosamine disaccharide-specific PTS system, IIA component (EC 2.7.1.69)
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36

Gene: SSA_0057: Predicted galactosamine disaccharide-specific PTS system, IIA component (EC 2.7.1.69)
 
Streptococcus suis 05ZYH33

Gene: SSU05_0453: Predicted galactosamine disaccharide-specific PTS system, IIA component (EC 2.7.1.69)
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J

Gene: SUB0046: Predicted galactosamine disaccharide-specific PTS system, IIA component (EC 2.7.1.69)
Predicted galactosamine disaccharide-specific PTS system, IIA component (EC 2.7.1.69)
 
CRON 2.
agaR
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
*
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Site:
position = -51
score = 5.31083
sequence = TTTTTTGTTATAATAGCTAA

Gene: SDEG_0678: N-acetylgalactosamine utilization transcriptional regulator AgaR, GntR family
*
Streptococcus equi subsp. zooepidemicus MGCS10565

Site:
position = -43
score = 4.74258
sequence = ATTTTTGCTATAATCGTATT

Gene: Sez_0740: N-acetylgalactosamine utilization transcriptional regulator AgaR, GntR family
 
Streptococcus gallolyticus UCN34
*
Streptococcus gordonii str. Challis substr. CH1

Site:
position = -107
score = 5.56188
sequence = TTAATTAATATAATAACATT

Gene: SGO_0042: N-acetylgalactosamine utilization transcriptional regulator AgaR, GntR family
*
Streptococcus mitis B6

Site:
position = -282
score = 5.48484
sequence = TTTGTTGATATATTAAATAT

Gene: smi_0078: N-acetylgalactosamine utilization transcriptional regulator AgaR, GntR family
 
Streptococcus mutans UA159
*
Streptococcus pneumoniae TIGR4

Site:
position = -312
score = 5.56325
sequence = TTTGTTGTTATATTAATTAT

Gene: SP_0058: N-acetylgalactosamine utilization transcriptional regulator AgaR, GntR family
 
Streptococcus pyogenes M1 GAS
*
Streptococcus sanguinis SK36

Site:
position = -98
score = 5.51401
sequence = AATATTAATATAATAAATTT

Gene: SSA_0052: N-acetylgalactosamine utilization transcriptional regulator AgaR, GntR family
*
Streptococcus suis 05ZYH33

Site:
position = -157
score = 4.90934
sequence = TCTATTAATATACTAACACT

Gene: SSU05_0448: N-acetylgalactosamine utilization transcriptional regulator AgaR, GntR family
 
Streptococcus thermophilus CNRZ1066
*
Streptococcus uberis 0140J

Site:
position = -53
score = 5.09114
sequence = ATTTCTGTTATAATAGTTCT

Gene: SUB0041: N-acetylgalactosamine utilization transcriptional regulator AgaR, GntR family
N-acetylgalactosamine utilization transcriptional regulator AgaR, GntR family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD