Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog PerR - Bacteroidaceae

Properties
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Peroxide stress response; Oxidative stress response
Effector: Hydrogen peroxide
Phylum: Bacteroidetes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 51 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bacteroides cellulosilyticus DSM 14838 9 4
Bacteroides dorei DSM 17855 13 7
Bacteroides eggerthii DSM 20697 9 4
Bacteroides fragilis NCTC 9343 6 3
Bacteroides ovatus ATCC 8483 5 3
Bacteroides plebeius DSM 17135 8 5
Bacteroides stercoris ATCC 43183 10 4
Bacteroides thetaiotaomicron VPI-5482 8 3
Bacteroides uniformis ATCC 8492 10 5
Bacteroides vulgatus ATCC 8482 12 7
Bacteroides coprophilus DSM 18228 9 6
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
perR
*
Bacteroides cellulosilyticus DSM 14838

Site:
position = -36
score = 6.58088
sequence = AAAAATGTAATTATTACAAGTTT

Gene: BACCELL_05678: Peroxide stress regulator PerR, Fur family
*
Bacteroides dorei DSM 17855

Site:
position = -30
score = 6.05145
sequence = AAAATTGTAATAGTTACAAAAAG

Gene: BACDOR_03683: Peroxide stress regulator PerR, Fur family
*
Bacteroides eggerthii DSM 20697

Site:
position = -37
score = 6.58088
sequence = AAAAATGTAATTATTACAAGTTT

Gene: BACEGG_01512: Peroxide stress regulator PerR, Fur family
*
Bacteroides fragilis NCTC 9343

Site:
position = -39
score = 6.80317
sequence = AAAATTGTAATGAATACAATTTT

Gene: BF3019: Peroxide stress regulator PerR, Fur family
*
Bacteroides ovatus ATCC 8483

Site:
position = -40
score = 6.32635
sequence = ATAATTGTAATGAATACAACTTT

Gene: BACOVA_00376: Peroxide stress regulator PerR, Fur family
*
Bacteroides plebeius DSM 17135

Site:
position = -33
score = 5.89881
sequence = AGAATTGTAACAATTACATAATT

Gene: BACPLE_02660: Peroxide stress regulator PerR, Fur family
*
Bacteroides stercoris ATCC 43183

Site:
position = -37
score = 6.58088
sequence = AAAAATGTAATTATTACAAGTTT

Gene: BACSTE_01825: Peroxide stress regulator PerR, Fur family
*
Bacteroides thetaiotaomicron VPI-5482

Site:
position = -40
score = 6.32635
sequence = ATAATTGTAATGAATACAACTTT

Gene: BT0215: Peroxide stress regulator PerR, Fur family
*
Bacteroides uniformis ATCC 8492

Site:
position = -38
score = 6.58088
sequence = AAAAATGTAATAATTACAAGTTT

Gene: BACUNI_01378: Peroxide stress regulator PerR, Fur family
*
Bacteroides vulgatus ATCC 8482

Site:
position = -30
score = 6.05145
sequence = AAAATTGTAATAGTTACAAAAAG

Gene: BVU_2366: Peroxide stress regulator PerR, Fur family
*
Bacteroides coprophilus DSM 18228

Site:
position = -33
score = 6.11174
sequence = AAAATTGTAATAGTTACAGAATT

Gene: BACCOPRO_01403: Peroxide stress regulator PerR, Fur family
Peroxide stress regulator PerR, Fur family
rbr
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_05679: Rubrerythrin
 
Bacteroides dorei DSM 17855

Gene: BACDOR_03684: Rubrerythrin
 
Bacteroides eggerthii DSM 20697

Gene: BACEGG_01511: Rubrerythrin
 
Bacteroides fragilis NCTC 9343

Gene: BF3018: Rubrerythrin
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_00378: Rubrerythrin
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_02659: Rubrerythrin
 
Bacteroides stercoris ATCC 43183

Gene: BACSTE_01824: Rubrerythrin
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT0216: Rubrerythrin
 
Bacteroides uniformis ATCC 8492

Gene: BACUNI_01379: Rubrerythrin
 
Bacteroides vulgatus ATCC 8482

Gene: BVU_2367: Rubrerythrin
 
Bacteroides coprophilus DSM 18228

Gene: BACCOPRO_01402: Rubrerythrin
Rubrerythrin
 
CRON 2.
rbr2
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_02076: Rubrerythrin
*
Bacteroides dorei DSM 17855

Site:
position = -93
score = 6.65395
sequence = ATAATTGTAATGAATACAATTTT

Gene: BACDOR_01950: Rubrerythrin
 
Bacteroides eggerthii DSM 20697

Gene: BACEGG_03320: Rubrerythrin
 
Bacteroides fragilis NCTC 9343

Gene: BF0020: Rubrerythrin
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_02877: Rubrerythrin
*
Bacteroides plebeius DSM 17135

Site:
position = -94
score = 6.67315
sequence = AAAATTGTAATGATTTCAAATTT

Gene: BACPLE_00297: Rubrerythrin
 
Bacteroides stercoris ATCC 43183

Gene: BACSTE_02366: Rubrerythrin
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT3182: Rubrerythrin
 
Bacteroides uniformis ATCC 8492

Gene: BACUNI_00484: Rubrerythrin
*
Bacteroides vulgatus ATCC 8482

Site:
position = -92
score = 6.36058
sequence = GTAATTGTAATAAATACAATTTT

Gene: BVU_1137: Rubrerythrin
*
Bacteroides coprophilus DSM 18228

Site:
position = -93
score = 6.80585
sequence = AAAGTTGTAATGATTACAATTTT

Gene: BACCOPRO_00127: Rubrerythrin
Rubrerythrin
 
CRON 3.
acn
*
Bacteroides cellulosilyticus DSM 14838

Site:
position = -47
score = 6.11365
sequence = TAATTTGTAATCTTTACAATATT

Gene: BACCELL_00993: Aconitate hydratase (EC 4.2.1.3)
*
Bacteroides dorei DSM 17855

Site:
position = -25
score = 5.94674
sequence = AAAACTGTAATAATTATAAATTG

Gene: BACDOR_03102: Aconitate hydratase (EC 4.2.1.3)
*
Bacteroides eggerthii DSM 20697

Site:
position = -48
score = 6.11365
sequence = TAATTTGTAATCTTTACAATATT

Gene: BACEGG_00294: Aconitate hydratase (EC 4.2.1.3)
 
Bacteroides fragilis NCTC 9343

Gene: BF3543: Aconitate hydratase (EC 4.2.1.3)
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_03310: Aconitate hydratase (EC 4.2.1.3)
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_01844: Aconitate hydratase (EC 4.2.1.3)
*
Bacteroides stercoris ATCC 43183

Site:
position = -45
score = 6.11365
sequence = TAATTTGTAATATTTACAATATT

Gene: BACSTE_03162: Aconitate hydratase (EC 4.2.1.3)
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT2072: Aconitate hydratase (EC 4.2.1.3)
*
Bacteroides uniformis ATCC 8492

Site:
position = -45
score = 5.96443
sequence = TAATTTGTAATCTTTACAATAAT

Gene: BACUNI_01674: Aconitate hydratase (EC 4.2.1.3)
*
Bacteroides vulgatus ATCC 8482

Site:
position = -19
score = 5.61328
sequence = AAAACTGTAATAATTATAAATGG

Gene: BVU_1959: Aconitate hydratase (EC 4.2.1.3)
 
Bacteroides coprophilus DSM 18228

Gene: BACCOPRO_00926: Aconitate hydratase (EC 4.2.1.3)
Aconitate hydratase (EC 4.2.1.3)
icd
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_00994: Isocitrate dehydrogenase [NADP] (EC 1.1.1.42)
 
Bacteroides dorei DSM 17855

Gene: BACDOR_03101: Isocitrate dehydrogenase [NADP] (EC 1.1.1.42)
 
Bacteroides eggerthii DSM 20697

Gene: BACEGG_00295: Isocitrate dehydrogenase [NADP] (EC 1.1.1.42)
 
Bacteroides fragilis NCTC 9343

Gene: BF3542: Isocitrate dehydrogenase [NADP] (EC 1.1.1.42)
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_03311: Isocitrate dehydrogenase [NADP] (EC 1.1.1.42)
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_01845: Isocitrate dehydrogenase [NADP] (EC 1.1.1.42)
 
Bacteroides stercoris ATCC 43183

Gene: BACSTE_03161: Isocitrate dehydrogenase [NADP] (EC 1.1.1.42)
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT2071: Isocitrate dehydrogenase [NADP] (EC 1.1.1.42)
 
Bacteroides uniformis ATCC 8492

Gene: BACUNI_01673: Isocitrate dehydrogenase [NADP] (EC 1.1.1.42)
 
Bacteroides vulgatus ATCC 8482

Gene: BVU_1960: Isocitrate dehydrogenase [NADP] (EC 1.1.1.42)
 
Bacteroides coprophilus DSM 18228

Gene: BACCOPRO_00927: Isocitrate dehydrogenase [NADP] (EC 1.1.1.42)
Isocitrate dehydrogenase [NADP] (EC 1.1.1.42)
gltA
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_00995: Citrate synthase (si) (EC 2.3.3.1)
 
Bacteroides dorei DSM 17855

Gene: BACDOR_03100: Citrate synthase (si) (EC 2.3.3.1)
 
Bacteroides eggerthii DSM 20697

Gene: BACEGG_00296: Citrate synthase (si) (EC 2.3.3.1)
 
Bacteroides fragilis NCTC 9343

Gene: BF3541: Citrate synthase (si) (EC 2.3.3.1)
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_03312: Citrate synthase (si) (EC 2.3.3.1)
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_01846: Citrate synthase (si) (EC 2.3.3.1)
 
Bacteroides stercoris ATCC 43183

Gene: BACSTE_03160: Citrate synthase (si) (EC 2.3.3.1)
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT_2070: Citrate synthase (si) (EC 2.3.3.1)
 
Bacteroides uniformis ATCC 8492

Gene: BACUNI_01672: Citrate synthase (si) (EC 2.3.3.1)
 
Bacteroides vulgatus ATCC 8482

Gene: BVU_1961: Citrate synthase (si) (EC 2.3.3.1)
 
Bacteroides coprophilus DSM 18228

Gene: BACCOPRO_00928: Citrate synthase (si) (EC 2.3.3.1)
Citrate synthase (si) (EC 2.3.3.1)
 
CRON 4.
PF05140
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
*
Bacteroides fragilis NCTC 9343

Site:
position = -86
score = 6.20775
sequence = AAAATTGTATTTAATACAAATTA

Gene: BF2364: ResB protein required for cytochrome c biosynthesis
 
Bacteroides ovatus ATCC 8483
*
Bacteroides plebeius DSM 17135

Site:
position = -79
score = 5.92314
sequence = AGATTTGTTATCTTTACAATTTT

Gene: BACPLE_02893: ResB protein required for cytochrome c biosynthesis
 
Bacteroides stercoris ATCC 43183
*
Bacteroides thetaiotaomicron VPI-5482

Site:
position = -94
score = 6.13119
sequence = CTACTTGTAACGATTACAATTTT

Gene: BT1604: ResB protein required for cytochrome c biosynthesis
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
*
Bacteroides coprophilus DSM 18228

Site:
position = -79
score = 5.96296
sequence = ACAATTGTTATCTTTACAATTTT

Gene: BACCOPRO_00708: ResB protein required for cytochrome c biosynthesis
ResB protein required for cytochrome c biosynthesis
ccsA
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343

Gene: BF2363: Cytochrome c biogenesis protein CcsA
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_02892: Cytochrome c biogenesis protein CcsA
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT1605: Cytochrome c biogenesis protein CcsA
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
 
Bacteroides coprophilus DSM 18228

Gene: BACCOPRO_00709: Cytochrome c biogenesis protein CcsA
Cytochrome c biogenesis protein CcsA
ccp
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343

Gene: BF2362: Cytochrome c551 peroxidase (EC 1.11.1.5)
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_02891: Cytochrome c551 peroxidase (EC 1.11.1.5)
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT1606: Cytochrome c551 peroxidase (EC 1.11.1.5)
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
 
Bacteroides coprophilus DSM 18228

Gene: BACCOPRO_00817: Cytochrome c551 peroxidase (EC 1.11.1.5)
Cytochrome c551 peroxidase (EC 1.11.1.5)
 
CRON 5.
tpx
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_00326: Thiol peroxidase, Tpx-type (EC 1.11.1.15)
*
Bacteroides dorei DSM 17855

Site:
position = -44
score = 5.69716
sequence = AAATTTGTTATCATTACAGTATC

Gene: BACDOR_00877: Thiol peroxidase, Tpx-type (EC 1.11.1.15)
 
Bacteroides eggerthii DSM 20697

Gene: BACEGG_01719: Thiol peroxidase, Tpx-type (EC 1.11.1.15)
 
Bacteroides fragilis NCTC 9343

Gene: BF2777: Thiol peroxidase, Tpx-type (EC 1.11.1.15)
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_00596: Thiol peroxidase, Tpx-type (EC 1.11.1.15)
 2
Bacteroides plebeius DSM 17135

Gene: BACPLE_03375: Thiol peroxidase, Tpx-type (EC 1.11.1.15)

Gene: BACPLE_02927: Thiol peroxidase, Tpx-type (EC 1.11.1.15)
 
Bacteroides stercoris ATCC 43183

Gene: BACSTE_00694: Thiol peroxidase, Tpx-type (EC 1.11.1.15)
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT1329: Thiol peroxidase, Tpx-type (EC 1.11.1.15)
*
Bacteroides uniformis ATCC 8492

Site:
position = -35
score = 5.00187
sequence = TAATTTGTTATGTATACATATAA

Gene: BACUNI_04341: Thiol peroxidase, Tpx-type (EC 1.11.1.15)
*
Bacteroides vulgatus ATCC 8482

Site:
position = -44
score = 5.69716
sequence = AAATTTGTTATCATTACAGTATC

Gene: BVU_3944: Thiol peroxidase, Tpx-type (EC 1.11.1.15)
*2
Bacteroides coprophilus DSM 18228

Site:
position = -56
score = 6.28634
sequence = ATATTTGTAATTATTACATATCT

Gene: BACCOPRO_01040: Thiol peroxidase, Tpx-type (EC 1.11.1.15)

Gene: BACCOPRO_00401: Thiol peroxidase, Tpx-type (EC 1.11.1.15)
Thiol peroxidase, Tpx-type (EC 1.11.1.15)
 
CRON 6.
ahpC
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_01721: Alkyl hydroperoxide reductase protein C (EC 1.6.4.-)
*
Bacteroides dorei DSM 17855

Site:
position = -55
score = 5.99653
sequence = GCAAATGTAATAATTACAATTTA

Gene: BACDOR_04898: Alkyl hydroperoxide reductase protein C (EC 1.6.4.-)
 
Bacteroides eggerthii DSM 20697

Gene: BACEGG_03370: Alkyl hydroperoxide reductase protein C (EC 1.6.4.-)
 
Bacteroides fragilis NCTC 9343

Gene: BF1210: Alkyl hydroperoxide reductase protein C (EC 1.6.4.-)
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_02068: Alkyl hydroperoxide reductase protein C (EC 1.6.4.-)
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183

Gene: BACSTE_02431: Alkyl hydroperoxide reductase protein C (EC 1.6.4.-)
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT2812: Alkyl hydroperoxide reductase protein C (EC 1.6.4.-)
 
Bacteroides uniformis ATCC 8492

Gene: BACUNI_01060: Alkyl hydroperoxide reductase protein C (EC 1.6.4.-)
*
Bacteroides vulgatus ATCC 8482

Site:
position = -55
score = 5.99653
sequence = GCAAATGTAATAATTACAATTTA

Gene: BVU_0847: Alkyl hydroperoxide reductase protein C (EC 1.6.4.-)
*
Bacteroides coprophilus DSM 18228

Site:
position = -55
score = 6.08268
sequence = TGCATTGTAATAATTACAAATTT

Gene: BACCOPRO_03297: Alkyl hydroperoxide reductase protein C (EC 1.6.4.-)
Alkyl hydroperoxide reductase protein C (EC 1.6.4.-)
ahpF
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_01722: Alkyl hydroperoxide reductase protein F (EC 1.6.4.-)
 
Bacteroides dorei DSM 17855

Gene: BACDOR_04897: Alkyl hydroperoxide reductase protein F (EC 1.6.4.-)
 
Bacteroides eggerthii DSM 20697

Gene: BACEGG_03369: Alkyl hydroperoxide reductase protein F (EC 1.6.4.-)
 
Bacteroides fragilis NCTC 9343

Gene: BF1209: Alkyl hydroperoxide reductase protein F (EC 1.6.4.-)
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_02067: Alkyl hydroperoxide reductase protein F (EC 1.6.4.-)
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183

Gene: BACSTE_02430: Alkyl hydroperoxide reductase protein F (EC 1.6.4.-)
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT2811: Alkyl hydroperoxide reductase protein F (EC 1.6.4.-)
 
Bacteroides uniformis ATCC 8492

Gene: BACUNI_01061: Alkyl hydroperoxide reductase protein F (EC 1.6.4.-)
 
Bacteroides vulgatus ATCC 8482

Gene: BVU_0846: Alkyl hydroperoxide reductase protein F (EC 1.6.4.-)
 
Bacteroides coprophilus DSM 18228

Gene: BACCOPRO_03296: Alkyl hydroperoxide reductase protein F (EC 1.6.4.-)
Alkyl hydroperoxide reductase protein F (EC 1.6.4.-)
 
CRON 7.
PF01637
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
*
Bacteroides fragilis NCTC 9343

Site:
position = -36
score = 5.86804
sequence = ATATTTGCAATAATTATAAATAT

Gene: BF3647: Archaeal ATPase family protein
*
Bacteroides ovatus ATCC 8483

Site:
position = -33
score = 5.6231
sequence = ATATTTGTAATAATTGTATTTAT

Gene: BACOVA_02789: Archaeal ATPase family protein
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
 
Bacteroides coprophilus DSM 18228
Archaeal ATPase family protein
 
CRON 8.
ftn
*
Bacteroides cellulosilyticus DSM 14838

Site:
position = -40
score = 5.76683
sequence = ACTTTTGTAATGATTTCAAATTA

Gene: BACCELL_00354: Ferritin
*
Bacteroides dorei DSM 17855

Site:
position = -41
score = 5.71924
sequence = ATATTTGCAACAGTTACAATTTA

Gene: BACDOR_04357: Ferritin
*
Bacteroides eggerthii DSM 20697

Site:
position = -39
score = 6.29861
sequence = ATATTTGTAATCATTTCAATTTA

Gene: BACEGG_01676: Ferritin
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
*
Bacteroides stercoris ATCC 43183

Site:
position = -39
score = 6.29861
sequence = ATATTTGTAATCATTTCAATTTA

Gene: BACSTE_00720: Ferritin
 
Bacteroides thetaiotaomicron VPI-5482
*
Bacteroides uniformis ATCC 8492

Site:
position = -36
score = 5.80666
sequence = ACTTTTGTAATGATTTCAATTTA

Gene: BACUNI_04391: Ferritin
*
Bacteroides vulgatus ATCC 8482

Site:
position = -40
score = 5.71924
sequence = ATATTTGCAACAGTTACAATTTA

Gene: BVU_2754: Ferritin
 
Bacteroides coprophilus DSM 18228
Ferritin
 
CRON 9.
PF00576
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
*
Bacteroides plebeius DSM 17135

Site:
position = -50
score = 6.07459
sequence = ATATTTGTAATTGTTACAATCTT

Gene: BACPLE_03494: Transthyretin family protein
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
 
Bacteroides coprophilus DSM 18228
Transthyretin family protein
 
CRON 10.
BT1211
*
Bacteroides cellulosilyticus DSM 14838

Site:
position = -29
score = 6.47936
sequence = ATATTTGTAATGATTATAAATTT

Gene: BACCELL_04244: hypothetical protein
*
Bacteroides dorei DSM 17855

Site:
position = -34
score = 5.93932
sequence = TTCTTTGTAATTATTACAACTTT

Gene: BACDOR_04415: hypothetical protein
*
Bacteroides eggerthii DSM 20697

Site:
position = -30
score = 6.20282
sequence = ATATTTGTAATGATTATAATTTG

Gene: BACEGG_02389: hypothetical protein
 
Bacteroides fragilis NCTC 9343
*
Bacteroides ovatus ATCC 8483

Site:
position = -35
score = 6.22455
sequence = ATATTTGTACTCATTACAAATTA

Gene: BACOVA_03967: hypothetical protein
*
Bacteroides plebeius DSM 17135

Site:
position = -28
score = 5.49418
sequence = TACTTTGTAATCATTATAAAAAT

Gene: BACPLE_02813: hypothetical protein
*
Bacteroides stercoris ATCC 43183

Site:
position = -29
score = 6.20282
sequence = ATATTTGTAATGATTATAATTTG

Gene: BACSTE_00833: hypothetical protein
*
Bacteroides thetaiotaomicron VPI-5482

Site:
position = -35
score = 6.1565
sequence = ATATTTGTACTCATTACAAATTC

Gene: BT1211: hypothetical protein
*
Bacteroides uniformis ATCC 8492

Site:
position = 70
score = 6.51919
sequence = ATATTTGTAATCATTATAATTTT

Gene: BACUNI_02171: hypothetical protein
 
Bacteroides vulgatus ATCC 8482
*
Bacteroides coprophilus DSM 18228

Site:
position = -28
score = 5.16072
sequence = TCCTTTGTAATTATTATAAAAAT

Gene: BACCOPRO_00522: hypothetical protein
hypothetical protein
BACSTE_02669
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183

Gene: BACSTE_00832: hypothetical protein
 
Bacteroides thetaiotaomicron VPI-5482
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
 
Bacteroides coprophilus DSM 18228
hypothetical protein
cydA
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_04245: Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-)
 
Bacteroides dorei DSM 17855

Gene: BACDOR_04414: Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-)
 
Bacteroides eggerthii DSM 20697

Gene: BACEGG_02390: Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-)
 
Bacteroides fragilis NCTC 9343

Gene: BF1937: Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-)
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_03968: Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-)
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_02811: Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-)
 
Bacteroides stercoris ATCC 43183

Gene: BACSTE_00831: Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-)
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT1210: Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-)
 
Bacteroides uniformis ATCC 8492

Gene: BACUNI_02172: Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-)
*
Bacteroides vulgatus ATCC 8482

Site:
position = -276
score = 5.93932
sequence = TTCTTTGTAATTATTACAACTTT

Gene: BVU_2799: Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-)
 
Bacteroides coprophilus DSM 18228

Gene: BACCOPRO_00524: Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-)
Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-)
cydB
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_04246: Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)
 
Bacteroides dorei DSM 17855

Gene: BACDOR_04413: Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)
 
Bacteroides eggerthii DSM 20697

Gene: BACEGG_02391: Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)
 
Bacteroides fragilis NCTC 9343

Gene: BF1938: Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_03969: Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_02810: Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)
 
Bacteroides stercoris ATCC 43183

Gene: BACSTE_00830: Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT1209: Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)
 
Bacteroides uniformis ATCC 8492

Gene: BACUNI_02173: Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)
 
Bacteroides vulgatus ATCC 8482

Gene: BVU_2798: Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)
 
Bacteroides coprophilus DSM 18228

Gene: BACCOPRO_00525: Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)
Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD