Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ManR - Bacteroidaceae

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Mannose utilization; Mannosides utilization
Effector: Mannose
Phylum: Bacteroidetes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 9 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bacteroides cellulosilyticus DSM 14838
Bacteroides dorei DSM 17855
Bacteroides eggerthii DSM 20697 10 3
Bacteroides fragilis NCTC 9343
Bacteroides ovatus ATCC 8483 10 3
Bacteroides plebeius DSM 17135
Bacteroides stercoris ATCC 43183
Bacteroides thetaiotaomicron VPI-5482 11 3
Bacteroides uniformis ATCC 8492
Bacteroides vulgatus ATCC 8482
Bacteroides coprophilus DSM 18228
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
manR
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides dorei DSM 17855
*
Bacteroides eggerthii DSM 20697

Site:
position = -119
score = 5.44144
sequence = TACTTTGTTTGAACATATAT

Gene: BACEGG_01984: Predicted transcriptional regulator of Mannose utilization, GntR family
 
Bacteroides fragilis NCTC 9343
*
Bacteroides ovatus ATCC 8483

Site:
position = 22
score = 5.86143
sequence = TTATATGTTCATACATACTT

Gene: BACOVA_03251: Predicted transcriptional regulator of Mannose utilization, GntR family
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
*
Bacteroides thetaiotaomicron VPI-5482

Site:
position = -108
score = 5.83282
sequence = TAGTATGTCTGAACATATAA

Gene: BT2103: Predicted transcriptional regulator of Mannose utilization, GntR family
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
 
Bacteroides coprophilus DSM 18228
Predicted transcriptional regulator of Mannose utilization, GntR family
 
CRON 2.
manK
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides dorei DSM 17855
*
Bacteroides eggerthii DSM 20697

Site:
position = -4
score = 5.60611
sequence = TATTATGTATGAACATGATA

Gene: BACEGG_01986: predicted mannose kinase, ROK family
 
Bacteroides fragilis NCTC 9343
*
Bacteroides ovatus ATCC 8483

Site:
position = -4
score = 5.13496
sequence = AACTATGTATGAACATGATG

Gene: BACOVA_03252: predicted mannose kinase, ROK family
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
 
Bacteroides coprophilus DSM 18228

Gene: BACCOPRO_02564: predicted mannose kinase, ROK family
predicted mannose kinase, ROK family
susC_Man-1
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697

Gene: BACEGG_01988: TonB-dependent outer membrane transporter of mannan oligomers
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_03253: TonB-dependent outer membrane transporter of mannan oligomers
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
*
Bacteroides thetaiotaomicron VPI-5482

Site:
position = -148
score = 5.86143
sequence = CAATATGTATATACATATAG

Gene: BT2107: TonB-dependent outer membrane transporter of mannan oligomers
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
 
Bacteroides coprophilus DSM 18228
TonB-dependent outer membrane transporter of mannan oligomers
susD_Man-1
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697

Gene: BACEGG_01989: Outer membrane polysaccharide binding protein for mannan oligomers
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_03254: Outer membrane polysaccharide binding protein for mannan oligomers
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT2108: Outer membrane polysaccharide binding protein for mannan oligomers
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
 
Bacteroides coprophilus DSM 18228
Outer membrane polysaccharide binding protein for mannan oligomers
PS51257
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697

Gene: BACEGG_01990: PROKAR_LIPOPROTEIN
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_03255: PROKAR_LIPOPROTEIN
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
 
Bacteroides coprophilus DSM 18228
PROKAR_LIPOPROTEIN
BACOVA_03256
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_03256: Glycoside hydrolase, family 76
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
 
Bacteroides coprophilus DSM 18228
hypothetical protein
BACOVA_03257
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_03257: Glycoside hydrolase, family 76
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
 
Bacteroides coprophilus DSM 18228
hypothetical protein
manA
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697

Gene: BACEGG_01991: putative alpha-1,2-mannosidase
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_03258: putative alpha-1,2-mannosidase
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT2111: putative alpha-1,2-mannosidase
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
 2
Bacteroides coprophilus DSM 18228

Gene: BACCOPRO_02570: putative alpha-1,2-mannosidase

Gene: BACCOPRO_02569: putative alpha-1,2-mannosidase
putative alpha-1,2-mannosidase
manP
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697

Gene: BACEGG_01993: Predicted mannose transporter, FucP family
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_03259: Predicted mannose transporter, FucP family
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT2106: Predicted mannose transporter, FucP family
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
 
Bacteroides coprophilus DSM 18228

Gene: BACCOPRO_02567: Predicted mannose transporter, FucP family
Predicted mannose transporter, FucP family
BACEGG_01987
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697

Gene: BACEGG_01987: hypothetical protein
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
 
Bacteroides coprophilus DSM 18228
hypothetical protein
BACEGG_01992
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697

Gene: BACEGG_01992: hypothetical protein
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
 
Bacteroides coprophilus DSM 18228
hypothetical protein
BT2109
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT2109: Galactose-binding domain-like
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
 
Bacteroides coprophilus DSM 18228
hypothetical protein
BT2110
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT2110: hypothetical protein
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
 
Bacteroides coprophilus DSM 18228
hypothetical protein
BT2112
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT2112: Glycosyl hydrolases family 43
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
 
Bacteroides coprophilus DSM 18228
hypothetical protein
BT2113
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT2113: Glycosyl hydrolases family 38, putative Alpha-mannosidase
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
 
Bacteroides coprophilus DSM 18228
Alpha-mannosidase (EC 3.2.1.24)
pmi
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides dorei DSM 17855
*
Bacteroides eggerthii DSM 20697

Site:
position = -29
score = 5.44144
sequence = ATATATGTTCAAACAAAGTA

Gene: BACEGG_01985: Mannose-6-phosphate isomerase (EC 5.3.1.8)
 
Bacteroides fragilis NCTC 9343
*
Bacteroides ovatus ATCC 8483

Site:
position = -4
score = 5.86143
sequence = AAGTATGTATGAACATATAA

Gene: BACOVA_03250: Mannose-6-phosphate isomerase (EC 5.3.1.8)
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
*
Bacteroides thetaiotaomicron VPI-5482

Site:
position = -41
score = 5.83282
sequence = TTATATGTTCAGACATACTA

Gene: BT2104: Mannose-6-phosphate isomerase (EC 5.3.1.8) / predicted mannose kinase, ROK family
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
 
Bacteroides coprophilus DSM 18228

Gene: BACCOPRO_02563: Mannose-6-phosphate isomerase (EC 5.3.1.8)
Mannose-6-phosphate isomerase (EC 5.3.1.8)
manA
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT2105: putative alpha-1,2-mannosidase
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
 
Bacteroides coprophilus DSM 18228
putative alpha-1,2-mannosidase
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD