Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog NanR - Bacteroidaceae

Properties
Regulator type: Transcription factor
Regulator family: ROK
Regulation mode: repressor
Biological process: Sialic acid utilization; N-acetylglucosamine utilization
Effector: N-acetylglucosamine; N-acetylneuraminic acid
Phylum: Bacteroidetes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 59 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bacteroides cellulosilyticus DSM 14838 5 2
Bacteroides coprophilus DSM 18228 9 2
Bacteroides dorei DSM 17855 18 4
Bacteroides eggerthii DSM 20697 12 4
Bacteroides fragilis NCTC 9343 25 7
Bacteroides ovatus ATCC 8483 18 4
Bacteroides plebeius DSM 17135 6 5
Bacteroides stercoris ATCC 43183 13 5
Bacteroides thetaiotaomicron VPI-5482 10 3
Bacteroides uniformis ATCC 8492 9 5
Bacteroides vulgatus ATCC 8482 18 5
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
BT0434
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
*
Bacteroides ovatus ATCC 8483

Site:
position = -100
score = 5.93026
sequence = TTAATAAAATATTTTATTATCTA

Site:
position = -103
score = 6.32503
sequence = TTATTAATAAAATATTTTATTAT

Gene: BACOVA_01792: NTP pyrophosphohydrolases including oxidative damage repair enzymes
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
*
Bacteroides thetaiotaomicron VPI-5482

Site:
position = -98
score = 6.32503
sequence = TTATTAATAAAATATTTTATTAT

Site:
position = -95
score = 5.93026
sequence = TTAATAAAATATTTTATTATCTA

Gene: BT0434: NTP pyrophosphohydrolases including oxidative damage repair enzymes
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
NTP pyrophosphohydrolases including oxidative damage repair enzymes
SSF51445
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_01793: Glycoside hydrolase, superfamily SSF51445
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT0435: Glycoside hydrolase, superfamily SSF51445
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
Glycoside hydrolase, superfamily SSF51445
nanJ
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_01794: Predicted sialic acid transporter, AraJ-MFS family
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT0436: Predicted sialic acid transporter, AraJ-MFS family
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
Predicted sialic acid transporter, AraJ-MFS family
nanE-II
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_01795: N-acylglucosamine 2-epimerase (EC 5.1.3.8)
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 2
Bacteroides thetaiotaomicron VPI-5482

Gene: BT0437: N-acylglucosamine 2-epimerase (EC 5.1.3.8)

Gene: BT0453: N-acylglucosamine 2-epimerase (EC 5.1.3.8)
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
N-acylglucosamine 2-epimerase (EC 5.1.3.8)
susC_Nan-4
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_01796: TonB-dependent outer membrane transporter of sialic acid oligomers
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT0452: TonB-dependent outer membrane transporter of sialic acid oligomers
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
TonB-dependent outer membrane transporter of sialic acid oligomers
susD_Nan-4
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_01797: Outer membrane polysaccharide binding protein for sialic acid oligomers
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT0451: Outer membrane polysaccharide binding protein for sialic acid oligomers
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
Outer membrane polysaccharide binding protein for sialic acid oligomers
BT0450
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_01798: hypothetical protein
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT0450: hypothetical protein
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
hypothetical protein
PF09992
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_01799: Predicted periplasmic protein, PF09992 family
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
Predicted periplasmic protein, PF09992 family
PF02638
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_01800: S-layer related protein precursor, sialic acid-specific 9-O-acetylesterase
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT0449: S-layer related protein precursor, sialic acid-specific 9-O-acetylesterase
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
S-layer related protein precursor, sialic acid-specific 9-O-acetylesterase
agaN
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT0438: Alpha-N-acetylglucosaminidase (EC 3.2.1.50)
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
Alpha-N-acetylglucosaminidase (EC 3.2.1.50)
 
CRON 2.
fucA
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697

Gene: BACEGG_02302: Alpha-L-fucosidase (EC 3.2.1.51)
*
Bacteroides fragilis NCTC 9343

Site:
position = -21
score = 5.28989
sequence = TATTTAATATAATTATATAATAT

Gene: BF1796: Alpha-L-fucosidase (EC 3.2.1.51)
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482
 
Bacteroides uniformis ATCC 8492
*
Bacteroides vulgatus ATCC 8482

Site:
position = -92
score = 6.08724
sequence = TTTTTAATAAATTATTTTATTAA

Gene: BVU_2433: Alpha-L-fucosidase (EC 3.2.1.51)
Alpha-L-fucosidase (EC 3.2.1.51)
susC_Nan-5
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides coprophilus DSM 18228
*
Bacteroides dorei DSM 17855

Site:
position = -163
score = 4.79853
sequence = GTTATAATAAAATATTTTTGTTT

Site:
position = -160
score = 4.95787
sequence = ATAATAAAATATTTTTGTTTATA

Gene: BACDOR_01206: TonB-dependent outer membrane transporter of sialic acid oligomers
 
Bacteroides eggerthii DSM 20697
*
Bacteroides fragilis NCTC 9343

Site:
position = -39
score = 5.29347
sequence = ATTATAATTTTCTTTATTATTAA

Gene: BF1719: TonB-dependent outer membrane transporter of sialic acid oligomers
 
Bacteroides ovatus ATCC 8483
*
Bacteroides plebeius DSM 17135

Site:
position = -267
score = 5.20857
sequence = TATATAAATAATATTTTTATCAT

Site:
position = -156
score = 5.01146
sequence = TTCATAAAATATTTTATCAAATA

Gene: BACPLE_00590: TonB-dependent outer membrane transporter of sialic acid oligomers
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482

Gene: BVU_2432: TonB-dependent outer membrane transporter of sialic acid oligomers
TonB-dependent outer membrane transporter of sialic acid oligomers
susD_Nan-5
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855

Gene: BACDOR_01207: Outer membrane polysaccharide binding protein for sialic acid oligomers
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343

Gene: BF1720: Outer membrane polysaccharide binding protein for sialic acid oligomers
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_00589: Outer membrane polysaccharide binding protein for sialic acid oligomers
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482

Gene: BVU_2431: Outer membrane polysaccharide binding protein for sialic acid oligomers
Outer membrane polysaccharide binding protein for sialic acid oligomers
 
CRON 3.
susC_Nan-6
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
*
Bacteroides stercoris ATCC 43183

Site:
position = -25
score = 5.29203
sequence = TAAATAACCAATTAAATTAATAT

Gene: BACSTE_02458: TonB-dependent outer membrane transporter of sialic acid oligomers
 
Bacteroides thetaiotaomicron VPI-5482
*
Bacteroides uniformis ATCC 8492

Site:
position = -25
score = 5.62419
sequence = TTAATAACTAATTAAATTAATAT

Site:
position = -21
score = 4.82124
sequence = TAACTAATTAAATTAATATTTAT

Gene: BACUNI_01022: TonB-dependent outer membrane transporter of sialic acid oligomers
 
Bacteroides vulgatus ATCC 8482
TonB-dependent outer membrane transporter of sialic acid oligomers
susD_Nan-6
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183

Gene: BACSTE_02457: Outer membrane polysaccharide binding protein for sialic acid oligomers
 
Bacteroides thetaiotaomicron VPI-5482
 
Bacteroides uniformis ATCC 8492

Gene: BACUNI_01023: Outer membrane polysaccharide binding protein for sialic acid oligomers
 
Bacteroides vulgatus ATCC 8482
Outer membrane polysaccharide binding protein for sialic acid oligomers
 
CRON 4.
exbB
*
Bacteroides cellulosilyticus DSM 14838

Site:
position = -44
score = 5.68674
sequence = ATAATAAACAAATTAATTAATTA

Gene: BACCELL_01010: Outer membrane transport system, transport protein ExbB
*
Bacteroides coprophilus DSM 18228

Site:
position = -43
score = 5.02072
sequence = TTTATAAACTATTAATTAATTAA

Gene: BACCOPRO_02433: Outer membrane transport system, transport protein ExbB
 
Bacteroides dorei DSM 17855

Gene: BACDOR_03120: Outer membrane transport system, transport protein ExbB
*
Bacteroides eggerthii DSM 20697

Site:
position = -44
score = 5.4656
sequence = ATAATAAGTAATTTAATTAATTA

Gene: BACEGG_00309: Outer membrane transport system, transport protein ExbB
*
Bacteroides fragilis NCTC 9343

Site:
position = -43
score = 5.46923
sequence = ATAATAATAATTTAATTAATTAA

Gene: BF3530: Outer membrane transport system, transport protein ExbB
*
Bacteroides ovatus ATCC 8483

Site:
position = -39
score = 4.81098
sequence = ATAATAATCAATTAATTAATCTT

Gene: BACOVA_00648: Outer membrane transport system, transport protein ExbB
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_03178: Outer membrane transport system, transport protein ExbB
*
Bacteroides stercoris ATCC 43183

Site:
position = -44
score = 5.4656
sequence = ATAATAAGTAATTTAATTAATTA

Gene: BACSTE_03148: Outer membrane transport system, transport protein ExbB
*
Bacteroides thetaiotaomicron VPI-5482

Site:
position = -39
score = 4.81098
sequence = ATAATAATCAATTAATTAATCTT

Gene: BT2055: Outer membrane transport system, transport protein ExbB
*
Bacteroides uniformis ATCC 8492

Site:
position = -44
score = 5.91523
sequence = ATAATAAATAAATTAATTAATTA

Gene: BACUNI_01658: Outer membrane transport system, transport protein ExbB
 
Bacteroides vulgatus ATCC 8482

Gene: BVU_1942: Outer membrane transport system, transport protein ExbB
Outer membrane transport system, transport protein ExbB
BACCELL_01011
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_01011: hypothetical protein
 
Bacteroides coprophilus DSM 18228

Gene: BACCOPRO_02432: hypothetical protein
 
Bacteroides dorei DSM 17855

Gene: BACDOR_03119: hypothetical protein
 
Bacteroides eggerthii DSM 20697

Gene: BACEGG_00310: hypothetical protein
 
Bacteroides fragilis NCTC 9343

Gene: BF3529: hypothetical protein
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_00649: hypothetical protein
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_03177: hypothetical protein
 
Bacteroides stercoris ATCC 43183

Gene: BACSTE_03147: hypothetical protein
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT2054: hypothetical protein
 
Bacteroides uniformis ATCC 8492

Gene: BACUNI_01657: hypothetical protein
 
Bacteroides vulgatus ATCC 8482

Gene: BVU_1943: hypothetical protein
hypothetical protein
exbD
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_01012: Outer membrane transport system, transport protein ExbD
 
Bacteroides coprophilus DSM 18228

Gene: BACCOPRO_02431: Outer membrane transport system, transport protein ExbD
 
Bacteroides dorei DSM 17855

Gene: BACDOR_03118: Outer membrane transport system, transport protein ExbD
 
Bacteroides eggerthii DSM 20697

Gene: BACEGG_00311: Outer membrane transport system, transport protein ExbD
 
Bacteroides fragilis NCTC 9343

Gene: BF3528: Outer membrane transport system, transport protein ExbD
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_00650: Outer membrane transport system, transport protein ExbD
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_03176: Outer membrane transport system, transport protein ExbD
 
Bacteroides stercoris ATCC 43183

Gene: BACSTE_03146: Outer membrane transport system, transport protein ExbD
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT2053: Outer membrane transport system, transport protein ExbD
 
Bacteroides uniformis ATCC 8492

Gene: BACUNI_01656: Outer membrane transport system, transport protein ExbD
 
Bacteroides vulgatus ATCC 8482

Gene: BVU_1944: Outer membrane transport system, transport protein ExbD
Outer membrane transport system, transport protein ExbD
exbD2
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_01013: Outer membrane transport system, transport protein ExbD
 
Bacteroides coprophilus DSM 18228

Gene: BACCOPRO_02430: Outer membrane transport system, transport protein ExbD
 
Bacteroides dorei DSM 17855

Gene: BACDOR_03117: Outer membrane transport system, transport protein ExbD
 
Bacteroides eggerthii DSM 20697

Gene: BACEGG_00312: Outer membrane transport system, transport protein ExbD
 
Bacteroides fragilis NCTC 9343

Gene: BF3527: Outer membrane transport system, transport protein ExbD
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_00651: Outer membrane transport system, transport protein ExbD
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_03175: Outer membrane transport system, transport protein ExbD
 
Bacteroides stercoris ATCC 43183

Gene: BACSTE_03145: Outer membrane transport system, transport protein ExbD
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT2052: Outer membrane transport system, transport protein ExbD
 
Bacteroides uniformis ATCC 8492

Gene: BACUNI_01655: Outer membrane transport system, transport protein ExbD
 
Bacteroides vulgatus ATCC 8482

Gene: BVU_1945: Outer membrane transport system, transport protein ExbD
Outer membrane transport system, transport protein ExbD
 
CRON 5.
nanT-II
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides coprophilus DSM 18228

Gene: BACCOPRO_02520: Predicted N-acetyl-neuraminate transporter, MFS family
 
Bacteroides dorei DSM 17855

Gene: BACDOR_00692: Predicted N-acetyl-neuraminate transporter, MFS family
*
Bacteroides eggerthii DSM 20697

Site:
position = -85
score = 5.98357
sequence = TTAATAAAATAATTTATTAAATA

Gene: BACEGG_02293: Predicted N-acetyl-neuraminate transporter, MFS family
 3
Bacteroides fragilis NCTC 9343

Gene: BF3708: Predicted N-acetyl-neuraminate transporter, MFS family

Gene: BF4054: Predicted N-acetyl-neuraminate transporter, MFS family

Gene: BF1714: Predicted N-acetyl-neuraminate transporter, MFS family
 2
Bacteroides ovatus ATCC 8483

Gene: BACOVA_00272: Predicted N-acetyl-neuraminate transporter, MFS family

Gene: BACOVA_04187: Predicted N-acetyl-neuraminate transporter, MFS family
 
Bacteroides plebeius DSM 17135
*
Bacteroides stercoris ATCC 43183

Site:
position = -94
score = 5.81104
sequence = TATTTAATAAAATAAATTATTAA

Gene: BACSTE_01904: Predicted N-acetyl-neuraminate transporter, MFS family
 
Bacteroides thetaiotaomicron VPI-5482
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482

Gene: BVU_4119: Predicted N-acetyl-neuraminate transporter, MFS family
Predicted N-acetyl-neuraminate transporter, MFS family
nanA
 
Bacteroides cellulosilyticus DSM 14838
*
Bacteroides coprophilus DSM 18228

Site:
position = -30
score = 5.75396
sequence = TAAATAAATAATTTTATTAAATA

Gene: BACCOPRO_02518: N-acetylneuraminate lyase (EC 4.1.3.3)
*
Bacteroides dorei DSM 17855

Site:
position = -111
score = 5.53927
sequence = TTATTAATAAATAAATTTAGTTT

Site:
position = -40
score = 4.80072
sequence = TAAGTAATATAAAATATTCATTT

Gene: BACDOR_00694: N-acetylneuraminate lyase (EC 4.1.3.3)
 
Bacteroides eggerthii DSM 20697

Gene: BACEGG_02294: N-acetylneuraminate lyase (EC 4.1.3.3)
*
Bacteroides fragilis NCTC 9343

Site:
position = -150
score = 6.32503
sequence = TTATTAATAAAATATTTTATTAT

Site:
position = -41
score = 5.28468
sequence = ATATTAAAAATCTATATCATTAA

Gene: BF1712: N-acetylneuraminate lyase (EC 4.1.3.3)
*
Bacteroides ovatus ATCC 8483

Site:
position = -194
score = 4.87603
sequence = AAAATAACTAAATATATTAAACT

Gene: BACOVA_00275: N-acetylneuraminate lyase (EC 4.1.3.3)
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183

Gene: BACSTE_01905: N-acetylneuraminate lyase (EC 4.1.3.3)
 
Bacteroides thetaiotaomicron VPI-5482
 
Bacteroides uniformis ATCC 8492
*
Bacteroides vulgatus ATCC 8482

Site:
position = -111
score = 5.53927
sequence = TTATTAATAAATAAATTTAGTTT

Site:
position = -108
score = 5.16778
sequence = TTAATAAATAAATTTAGTTTTTA

Site:
position = -40
score = 4.80072
sequence = TAAGTAATATAAAATATTCATTT

Gene: BVU_4117: N-acetylneuraminate lyase (EC 4.1.3.3)
N-acetylneuraminate lyase (EC 4.1.3.3)
nanE-II
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides coprophilus DSM 18228

Gene: BACCOPRO_02519: N-acetylmannosamine 2-epimerase
 
Bacteroides dorei DSM 17855

Gene: BACDOR_00693: N-acetylmannosamine 2-epimerase
 
Bacteroides eggerthii DSM 20697

Gene: BACEGG_02295: N-acetylmannosamine 2-epimerase
 2
Bacteroides fragilis NCTC 9343

Gene: BF4053: N-acetylmannosamine 2-epimerase

Gene: BF1713: N-acetylmannosamine 2-epimerase
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_00274: N-acetylmannosamine 2-epimerase
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183

Gene: BACSTE_01906: N-acetylmannosamine 2-epimerase
 
Bacteroides thetaiotaomicron VPI-5482
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482

Gene: BVU_4118: N-acetylmannosamine 2-epimerase
N-acetylmannosamine 2-epimerase
susC_Nan-1
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697

Gene: BACEGG_02296: TonB-dependent outer membrane transporter of sialic acid oligomers
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_00281: TonB-dependent outer membrane transporter of sialic acid oligomers
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482
 
Bacteroides uniformis ATCC 8492
*
Bacteroides vulgatus ATCC 8482

Site:
position = -38
score = 5.0034
sequence = AAGTTCATTTAATTTTTTAATTA

Site:
position = -18
score = 5.09965
sequence = TTAATAAATTACTAATTTATGAA

Gene: BVU_2029: TonB-dependent outer membrane transporter of sialic acid oligomers
TonB-dependent outer membrane transporter of sialic acid oligomers
susD_Nan-1
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 2
Bacteroides eggerthii DSM 20697

Gene: BACEGG_02297: Outer membrane polysaccharide binding protein for sialic acid oligomers

Gene: BACEGG_02299: Outer membrane polysaccharide binding protein for sialic acid oligomers
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_00280: Outer membrane polysaccharide binding protein for sialic acid oligomers
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482

Gene: BVU_2030: Outer membrane polysaccharide binding protein for sialic acid oligomers
Outer membrane polysaccharide binding protein for sialic acid oligomers
GH43
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697

Gene: BACEGG_02298: Glycosyl hydrolase family 43, five-bladed beta-propellor domain
 
Bacteroides fragilis NCTC 9343
 2
Bacteroides ovatus ATCC 8483

Gene: BACOVA_00279: Glycosyl hydrolase family 43, five-bladed beta-propellor domain

Gene: BACOVA_00278: Glycosyl hydrolase family 43, five-bladed beta-propellor domain
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482
 
Bacteroides uniformis ATCC 8492
*
Bacteroides vulgatus ATCC 8482

Site:
position = -5
score = 4.97964
sequence = TAATTATGAAAGTATTTTATTAT

Gene: BVU_2031: Glycosyl hydrolase family 43, five-bladed beta-propellor domain
Glycosyl hydrolase family 43, five-bladed beta-propellor domain
nanH2
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 2
Bacteroides stercoris ATCC 43183

Gene: BACSTE_01908: Sialidase (EC 3.2.1.18)

Gene: nanH2: Sialidase (EC 3.2.1.18)
 
Bacteroides thetaiotaomicron VPI-5482
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
Sialidase (EC 3.2.1.18)
PF04074
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides coprophilus DSM 18228

Gene: BACCOPRO_02521: Conserved hypothetical protein, PF04074 family
 
Bacteroides dorei DSM 17855
*
Bacteroides eggerthii DSM 20697

Site:
position = -94
score = 6.22136
sequence = ATAATAAAATAATTTATTAATTA

Gene: BACEGG_02292: Conserved hypothetical protein, PF04074 family
 
Bacteroides fragilis NCTC 9343

Gene: BF1715: Conserved hypothetical protein, PF04074 family
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_00273: Conserved hypothetical protein, PF04074 family
 
Bacteroides plebeius DSM 17135
*
Bacteroides stercoris ATCC 43183

Site:
position = -92
score = 5.96268
sequence = ATAATAAAATAATTTATTATATA

Gene: BACSTE_01903: Conserved hypothetical protein, PF04074 family
 
Bacteroides thetaiotaomicron VPI-5482
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
Conserved hypothetical protein, PF04074 family
nanH
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides coprophilus DSM 18228

Gene: BACCOPRO_02522: Sialidase (EC 3.2.1.18)
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343

Gene: BF3709: Sialidase (EC 3.2.1.18)
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_04188: Sialidase (EC 3.2.1.18)
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183

Gene: BACSTE_01982: Sialidase (EC 3.2.1.18)
 
Bacteroides thetaiotaomicron VPI-5482
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
Sialidase (EC 3.2.1.18)
nagB
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_03156: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
 
Bacteroides coprophilus DSM 18228

Gene: BACCOPRO_00900: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
 
Bacteroides dorei DSM 17855

Gene: BACDOR_00691: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
 
Bacteroides eggerthii DSM 20697

Gene: BACEGG_00885: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
 
Bacteroides fragilis NCTC 9343

Gene: BF0905: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_04936: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
*
Bacteroides plebeius DSM 17135

Site:
position = -122
score = 4.85633
sequence = TAAAAAATCTATTTTTTTATTTG

Gene: BACPLE_01828: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
 
Bacteroides stercoris ATCC 43183

Gene: BACSTE_03266: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT4127: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
 
Bacteroides uniformis ATCC 8492

Gene: BACUNI_03579: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
 
Bacteroides vulgatus ATCC 8482

Gene: BVU_4120: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
nagB-II
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_05102: Glucosamine-6-phosphate deaminase (EC 3.5.99.6) / putative N-acetylglucosaminylphosphatidylinositol de-N-acetylase ( EC:3.5.1.89)
 
Bacteroides coprophilus DSM 18228

Gene: BACCOPRO_00899: Glucosamine-6-phosphate deaminase (EC 3.5.99.6) / putative N-acetylglucosaminylphosphatidylinositol de-N-acetylase ( EC:3.5.1.89)
 
Bacteroides dorei DSM 17855

Gene: BACDOR_00690: Glucosamine-6-phosphate deaminase (EC 3.5.99.6) / putative N-acetylglucosaminylphosphatidylinositol de-N-acetylase ( EC:3.5.1.89)
 
Bacteroides eggerthii DSM 20697

Gene: BACEGG_02099: Glucosamine-6-phosphate deaminase (EC 3.5.99.6) / putative N-acetylglucosaminylphosphatidylinositol de-N-acetylase ( EC:3.5.1.89)
*
Bacteroides fragilis NCTC 9343

Site:
position = -128
score = 4.75556
sequence = TAGGTAAAAAAAGATTTTAATTT

Gene: BF2953: Glucosamine-6-phosphate deaminase (EC 3.5.99.6) / putative N-acetylglucosaminylphosphatidylinositol de-N-acetylase ( EC:3.5.1.89)
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_00411: Glucosamine-6-phosphate deaminase (EC 3.5.99.6) / putative N-acetylglucosaminylphosphatidylinositol de-N-acetylase ( EC:3.5.1.89)
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_01827: Glucosamine-6-phosphate deaminase (EC 3.5.99.6) / putative N-acetylglucosaminylphosphatidylinositol de-N-acetylase ( EC:3.5.1.89)
 
Bacteroides stercoris ATCC 43183

Gene: BACSTE_01808: Glucosamine-6-phosphate deaminase (EC 3.5.99.6) / putative N-acetylglucosaminylphosphatidylinositol de-N-acetylase ( EC:3.5.1.89)
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT0258: Glucosamine-6-phosphate deaminase (EC 3.5.99.6) / putative N-acetylglucosaminylphosphatidylinositol de-N-acetylase ( EC:3.5.1.89)
*
Bacteroides uniformis ATCC 8492

Site:
position = -18
score = 5.3183
sequence = TTATTAATAATAAATTTTATGAA

Gene: BACUNI_01404: Glucosamine-6-phosphate deaminase (EC 3.5.99.6) / putative N-acetylglucosaminylphosphatidylinositol de-N-acetylase ( EC:3.5.1.89)
 
Bacteroides vulgatus ATCC 8482

Gene: BVU_4121: Glucosamine-6-phosphate deaminase (EC 3.5.99.6) / putative N-acetylglucosaminylphosphatidylinositol de-N-acetylase ( EC:3.5.1.89)
Glucosamine-6-phosphate deaminase (EC 3.5.99.6) / putative N-acetylglucosaminylphosphatidylinositol de-N-acetylase ( EC:3.5.1.89)
 
CRON 6.
nanR
*
Bacteroides cellulosilyticus DSM 14838

Site:
position = -37
score = 5.47192
sequence = ATATTAATAAAATTATTAAGTAT

Gene: BACCELL_04950: Putative N-acetylglucosamine repressor of sialic acid catabolism, ROK family
 
Bacteroides coprophilus DSM 18228

Gene: BACCOPRO_02516: Putative N-acetylglucosamine repressor of sialic acid catabolism, ROK family
*
Bacteroides dorei DSM 17855

Site:
position = -217
score = 5.53927
sequence = AAACTAAATTTATTTATTAATAA

Gene: BACDOR_00695: Putative N-acetylglucosamine repressor of sialic acid catabolism, ROK family
*
Bacteroides eggerthii DSM 20697

Site:
position = -58
score = 6.22136
sequence = TAATTAATAAATTATTTTATTAT

Gene: BACEGG_02291: Putative N-acetylglucosamine repressor of sialic acid catabolism, ROK family
*
Bacteroides fragilis NCTC 9343

Site:
position = -52
score = 4.79728
sequence = TTAATAAACAAATTAACTATCTT

Gene: BF1711: Putative N-acetylglucosamine repressor of sialic acid catabolism, ROK family
*
Bacteroides ovatus ATCC 8483

Site:
position = -50
score = 5.75913
sequence = TTAATAAAAAAATTAATTATCTT

Gene: BACOVA_01791: Putative N-acetylglucosamine repressor of sialic acid catabolism, ROK family
*
Bacteroides plebeius DSM 17135

Site:
position = -88
score = 5.43526
sequence = TAAATATAATAATTTATTAATGA

Gene: BACPLE_00597: Putative N-acetylglucosamine repressor of sialic acid catabolism, ROK family
*
Bacteroides stercoris ATCC 43183

Site:
position = -242
score = 5.96268
sequence = TATATAATAAATTATTTTATTAT

Gene: BACSTE_01902: Putative N-acetylglucosamine repressor of sialic acid catabolism, ROK family
*
Bacteroides thetaiotaomicron VPI-5482

Site:
position = -51
score = 5.75913
sequence = TTAATAAAAAAATTAATTATCTT

Gene: BT0433: Putative N-acetylglucosamine repressor of sialic acid catabolism, ROK family
*
Bacteroides uniformis ATCC 8492

Site:
position = -52
score = 5.09036
sequence = AATTTACAAAATTATTTTAGTAT

Gene: BACUNI_02075: Putative N-acetylglucosamine repressor of sialic acid catabolism, ROK family
*
Bacteroides vulgatus ATCC 8482

Site:
position = -190
score = 5.53927
sequence = AAACTAAATTTATTTATTAATAA

Gene: BVU_4116: Putative N-acetylglucosamine repressor of sialic acid catabolism, ROK family
Putative N-acetylglucosamine repressor of sialic acid catabolism, ROK family
 
CRON 7.
nanH
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides coprophilus DSM 18228
*
Bacteroides dorei DSM 17855

Site:
position = -47
score = 4.76537
sequence = ATTTCAATAAAAACTTTTATTTT

Gene: BACDOR_00663: Sialidase (EC 3.2.1.18)
 
Bacteroides eggerthii DSM 20697
*
Bacteroides fragilis NCTC 9343

Site:
position = -91
score = 5.56788
sequence = TATATAATAAAATATTTAATTAA

Site:
position = -88
score = 6.09964
sequence = ATAATAAAATATTTAATTAATAT

Gene: BF1806: Sialidase (EC 3.2.1.18)
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183

Gene: BACSTE_01982: Sialidase (EC 3.2.1.18)
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT0455: Sialidase (EC 3.2.1.18)
 
Bacteroides uniformis ATCC 8492
*
Bacteroides vulgatus ATCC 8482

Site:
position = -47
score = 4.76537
sequence = ATTTCAATAAAAACTTTTATTTT

Gene: BVU_4143: Sialidase (EC 3.2.1.18)
Sialidase (EC 3.2.1.18)
nahA
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides coprophilus DSM 18228

Gene: BACCOPRO_02672: Beta-hexosaminidase (EC 3.2.1.52)
 
Bacteroides dorei DSM 17855

Gene: BACDOR_00664: Beta-hexosaminidase (EC 3.2.1.52)
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343

Gene: BF1807: Beta-hexosaminidase (EC 3.2.1.52)
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT0456: Beta-hexosaminidase (EC 3.2.1.52)
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482

Gene: BVU_4142: Beta-hexosaminidase (EC 3.2.1.52)
Beta-hexosaminidase (EC 3.2.1.52)
estA
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855

Gene: BACDOR_00665: Sialate-O-acetyltransferase
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343

Gene: BF1808: Sialate-O-acetyltransferase
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_00586: Sialate-O-acetyltransferase
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482

Gene: BVU_4141: Sialate-O-acetyltransferase
Sialate-O-acetyltransferase
estS
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides coprophilus DSM 18228

Gene: BACCOPRO_02673: Sialic acid-specific 9-O-acetylesterase
 
Bacteroides dorei DSM 17855

Gene: BACDOR_00666: Sialic acid-specific 9-O-acetylesterase
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343

Gene: BF1809: Sialic acid-specific 9-O-acetylesterase
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_00585: Sialic acid-specific 9-O-acetylesterase
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT0457: Sialic acid-specific 9-O-acetylesterase
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482

Gene: BVU_4140: Sialic acid-specific 9-O-acetylesterase
Sialic acid-specific 9-O-acetylesterase
bmnA
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides coprophilus DSM 18228

Gene: BACCOPRO_00890: Beta-mannosidase (EC 3.2.1.25)
 
Bacteroides dorei DSM 17855

Gene: BACDOR_00667: Beta-mannosidase (EC 3.2.1.25)
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343

Gene: BF1810: Beta-mannosidase (EC 3.2.1.25)
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_00562: Beta-mannosidase (EC 3.2.1.25)
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_00244: Beta-mannosidase (EC 3.2.1.25)
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT0458: Beta-mannosidase (EC 3.2.1.25)
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482

Gene: BVU_4139: Beta-mannosidase (EC 3.2.1.25)
Beta-mannosidase (EC 3.2.1.25)
nahB
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides coprophilus DSM 18228

Gene: BACCOPRO_00891: Beta-hexosaminidase (EC 3.2.1.52)
 
Bacteroides dorei DSM 17855

Gene: BACDOR_00668: Beta-hexosaminidase (EC 3.2.1.52)
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343

Gene: BF1811: Beta-hexosaminidase (EC 3.2.1.52)
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_00560: Beta-hexosaminidase (EC 3.2.1.52)
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_00243: Beta-hexosaminidase (EC 3.2.1.52)
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT0459: Beta-hexosaminidase (EC 3.2.1.52)
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482

Gene: BVU_4138: Beta-hexosaminidase (EC 3.2.1.52)
Beta-hexosaminidase (EC 3.2.1.52)
nanM
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides coprophilus DSM 18228

Gene: BACCOPRO_02517: Sialic acid-induced transmembrane protein YjhT(NanM), possible mutarotase
 
Bacteroides dorei DSM 17855

Gene: BACDOR_00669: Sialic acid-induced transmembrane protein YjhT(NanM), possible mutarotase
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343

Gene: BF1812: Sialic acid-induced transmembrane protein YjhT(NanM), possible mutarotase
 
Bacteroides ovatus ATCC 8483
*
Bacteroides plebeius DSM 17135

Site:
position = -234
score = 5.43526
sequence = TCATTAATAAATTATTATATTTA

Gene: BACPLE_00596: Sialic acid-induced transmembrane protein YjhT(NanM), possible mutarotase
 
Bacteroides stercoris ATCC 43183

Gene: BACSTE_01984: Sialic acid-induced transmembrane protein YjhT(NanM), possible mutarotase
 
Bacteroides thetaiotaomicron VPI-5482
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482

Gene: BVU_4137: Sialic acid-induced transmembrane protein YjhT(NanM), possible mutarotase
Sialic acid-induced transmembrane protein YjhT(NanM), possible mutarotase
nahC
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides coprophilus DSM 18228

Gene: BACCOPRO_00892: Beta-hexosaminidase (EC 3.2.1.52)
 
Bacteroides dorei DSM 17855

Gene: BACDOR_00670: Beta-hexosaminidase (EC 3.2.1.52)
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343

Gene: BF1813: Beta-hexosaminidase (EC 3.2.1.52)
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_00559: Beta-hexosaminidase (EC 3.2.1.52)
*
Bacteroides plebeius DSM 17135

Site:
position = -81
score = 4.98089
sequence = ATAATAAATTTATATATTTACAT

Gene: BACPLE_02962: Beta-hexosaminidase (EC 3.2.1.52)
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT0460: Beta-hexosaminidase (EC 3.2.1.52)
 
Bacteroides uniformis ATCC 8492

Gene: BACUNI_01184: Beta-hexosaminidase (EC 3.2.1.52)
 
Bacteroides vulgatus ATCC 8482

Gene: BVU_4136: Beta-hexosaminidase (EC 3.2.1.52)
Beta-hexosaminidase (EC 3.2.1.52)
manA
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_03390: Alpha-1,2-mannosidase
 
Bacteroides coprophilus DSM 18228

Gene: BACCOPRO_00893: Alpha-1,2-mannosidase
 
Bacteroides dorei DSM 17855

Gene: BACDOR_00671: Alpha-1,2-mannosidase
 
Bacteroides eggerthii DSM 20697
*
Bacteroides fragilis NCTC 9343

Site:
position = -27
score = 5.13231
sequence = ATATTAATAAATAATAGTATTGA

Gene: BF1814: Alpha-1,2-mannosidase
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_04111: Alpha-1,2-mannosidase
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_00486: Alpha-1,2-mannosidase
 
Bacteroides stercoris ATCC 43183

Gene: BACSTE_03539: Alpha-1,2-mannosidase
 
Bacteroides thetaiotaomicron VPI-5482
 
Bacteroides uniformis ATCC 8492

Gene: BACUNI_02635: Alpha-1,2-mannosidase
 
Bacteroides vulgatus ATCC 8482

Gene: BVU_4135: Alpha-1,2-mannosidase
Alpha-1,2-mannosidase
bgaA
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_05450: Beta-galactosidase (EC 3.2.1.23)
 
Bacteroides coprophilus DSM 18228

Gene: BACCOPRO_00203: Beta-galactosidase (EC 3.2.1.23)
 
Bacteroides dorei DSM 17855

Gene: BACDOR_00672: Beta-galactosidase (EC 3.2.1.23)
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343

Gene: BF1815: Beta-galactosidase (EC 3.2.1.23)
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_05487: Beta-galactosidase (EC 3.2.1.23)
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_00247: Beta-galactosidase (EC 3.2.1.23)
 
Bacteroides stercoris ATCC 43183

Gene: BACSTE_01654: Beta-galactosidase (EC 3.2.1.23)
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT0461: Beta-galactosidase (EC 3.2.1.23)
*
Bacteroides uniformis ATCC 8492

Site:
position = -26
score = 4.96758
sequence = ATATTAACAAAATCTTTTAAAGA

Gene: BACUNI_01205: Beta-galactosidase (EC 3.2.1.23)
 
Bacteroides vulgatus ATCC 8482

Gene: BVU_4134: Beta-galactosidase (EC 3.2.1.23)
Beta-galactosidase (EC 3.2.1.23)
susC_Nan-3
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_04824: TonB-dependent outer membrane transporter of sialic acid oligomers
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343

Gene: BF1816: TonB-dependent outer membrane transporter of sialic acid oligomers
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_00558: TonB-dependent outer membrane transporter of sialic acid oligomers
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_00727: TonB-dependent outer membrane transporter of sialic acid oligomers
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT0483: TonB-dependent outer membrane transporter of sialic acid oligomers
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
TonB-dependent outer membrane transporter of sialic acid oligomers
susD_Nan-3
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_04823: Outer membrane polysaccharide binding protein for sialic acid oligomers
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343

Gene: BF1817: Outer membrane polysaccharide binding protein for sialic acid oligomers
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_00557: Outer membrane polysaccharide binding protein for sialic acid oligomers
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_00728: Outer membrane polysaccharide binding protein for sialic acid oligomers
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT0484: Outer membrane polysaccharide binding protein for sialic acid oligomers
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
Outer membrane polysaccharide binding protein for sialic acid oligomers
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD