Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CtsR - Lactobacillaceae

Properties
Regulator type: Transcription factor
Regulator family: CtsR
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 44 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Lactobacillus acidophilus NCFM
Lactobacillus brevis ATCC 367 5 4
Lactobacillus casei ATCC 334 4 3
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
Lactobacillus fermentum IFO 3956 8 4
Lactobacillus helveticus DPC 4571
Lactobacillus johnsonii NCC 533
Lactobacillus plantarum WCFS1 9 5
Lactobacillus reuteri JCM 1112 8 4
Lactobacillus rhamnosus GG 5 4
Lactobacillus sakei subsp. sakei 23K 9 5
Lactobacillus salivarius subsp. salivarius UCC118 5 4
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
Oenococcus oeni PSU-1 10 6
Pediococcus pentosaceus ATCC 25745 10 5
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
hrcA
 
Lactobacillus acidophilus NCFM

Gene: LBA1249: Heat shock response transcriptional regulator HrcA, HrcA family
 
Lactobacillus brevis ATCC 367

Gene: LVIS_1331: Heat shock response transcriptional regulator HrcA, HrcA family
 
Lactobacillus casei ATCC 334

Gene: LSEI_1567: Heat shock response transcriptional regulator HrcA, HrcA family
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Gene: LBUL_1229: Heat shock response transcriptional regulator HrcA, HrcA family
*
Lactobacillus fermentum IFO 3956

Site:
position = -89
score = 6.36329
sequence = AGATCTTTGACTTTTGTTGACTTT

Gene: LAF_0749: Heat shock response transcriptional regulator HrcA, HrcA family
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533

Gene: LJ1481: Heat shock response transcriptional regulator HrcA, HrcA family
*
Lactobacillus plantarum WCFS1

Site:
position = -91
score = 5.89627
sequence = AATACTTTGTCTTTCCTTGACTTT

Gene: lp_2029: Heat shock response transcriptional regulator HrcA, HrcA family
*
Lactobacillus reuteri JCM 1112

Site:
position = -101
score = 6.54452
sequence = AATTGTTTGACGTTTCTTGACTTT

Gene: LAR_0677: Heat shock response transcriptional regulator HrcA, HrcA family
 
Lactobacillus rhamnosus GG

Gene: LGG_01606: Heat shock response transcriptional regulator HrcA, HrcA family
*
Lactobacillus sakei subsp. sakei 23K

Site:
position = -87
score = 5.25267
sequence = CAATTCTTGACTTTATTTGACGTT

Gene: LSA1238: Heat shock response transcriptional regulator HrcA, HrcA family
 
Lactobacillus salivarius subsp. salivarius UCC118

Gene: LSL_0576: Heat shock response transcriptional regulator HrcA, HrcA family
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Gene: LEUM_1349: Heat shock response transcriptional regulator HrcA, HrcA family
 
Oenococcus oeni PSU-1
*
Pediococcus pentosaceus ATCC 25745

Site:
position = -107
score = 5.98678
sequence = AGATGTCTGACCAAATTTGACTAT

Gene: PEPE_0894: Heat shock response transcriptional regulator HrcA, HrcA family
Heat shock response transcriptional regulator HrcA, HrcA family
grpE
 
Lactobacillus acidophilus NCFM

Gene: LBA1248: Heat shock protein GrpE
 
Lactobacillus brevis ATCC 367

Gene: LVIS_1330: Heat shock protein GrpE
 
Lactobacillus casei ATCC 334

Gene: LSEI_1566: Heat shock protein GrpE
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Gene: LBUL_1228: Heat shock protein GrpE
 
Lactobacillus fermentum IFO 3956

Gene: LAF_0750: Heat shock protein GrpE
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533

Gene: LJ1480: Heat shock protein GrpE
 
Lactobacillus plantarum WCFS1

Gene: lp_2028: Heat shock protein GrpE
 
Lactobacillus reuteri JCM 1112

Gene: LAR_0678: Heat shock protein GrpE
 
Lactobacillus rhamnosus GG

Gene: LGG_01605: Heat shock protein GrpE
 
Lactobacillus sakei subsp. sakei 23K

Gene: LSA1237: Heat shock protein GrpE
 
Lactobacillus salivarius subsp. salivarius UCC118

Gene: LSL_0577: Heat shock protein GrpE
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Gene: LEUM_1348: Heat shock protein GrpE
*
Oenococcus oeni PSU-1

Site:
position = -71
score = 6.53601
sequence = AAATGTTTGACCAATCTTGACTAT

Gene: OEOE_1310: Heat shock protein GrpE
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_0895: Heat shock protein GrpE
Heat shock protein GrpE
dnaK
 
Lactobacillus acidophilus NCFM

Gene: LBA1247: Chaperone protein DnaK
 
Lactobacillus brevis ATCC 367

Gene: LVIS_1329: Chaperone protein DnaK
 
Lactobacillus casei ATCC 334

Gene: LSEI_1565: Chaperone protein DnaK
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Gene: LBUL_1227: Chaperone protein DnaK
 
Lactobacillus fermentum IFO 3956

Gene: LAF_0751: Chaperone protein DnaK
 
Lactobacillus helveticus DPC 4571

Gene: lhv_1336: Chaperone protein DnaK
 
Lactobacillus johnsonii NCC 533

Gene: LJ1479: Chaperone protein DnaK
 
Lactobacillus plantarum WCFS1

Gene: lp_2027: Chaperone protein DnaK
 
Lactobacillus reuteri JCM 1112

Gene: LAR_0679: Chaperone protein DnaK
 
Lactobacillus rhamnosus GG

Gene: LGG_01604: Chaperone protein DnaK
 
Lactobacillus sakei subsp. sakei 23K

Gene: LSA1236: Chaperone protein DnaK
 
Lactobacillus salivarius subsp. salivarius UCC118

Gene: LSL_0578: Chaperone protein DnaK
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Gene: LEUM_1347: Chaperone protein DnaK
 
Oenococcus oeni PSU-1

Gene: OEOE_1309: Chaperone protein DnaK
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_0896: Chaperone protein DnaK
Chaperone protein DnaK
dnaJ
 
Lactobacillus acidophilus NCFM

Gene: LBA1246: Chaperone protein DnaJ
 
Lactobacillus brevis ATCC 367

Gene: LVIS_1328: Chaperone protein DnaJ
 
Lactobacillus casei ATCC 334

Gene: LSEI_1563: Chaperone protein DnaJ
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Gene: LBUL_1226: Chaperone protein DnaJ
 
Lactobacillus fermentum IFO 3956

Gene: LAF_0752: Chaperone protein DnaJ
 
Lactobacillus helveticus DPC 4571

Gene: lhv_1335: Chaperone protein DnaJ
 
Lactobacillus johnsonii NCC 533

Gene: LJ1478: Chaperone protein DnaJ
 
Lactobacillus plantarum WCFS1

Gene: lp_2026: Chaperone protein DnaJ
 
Lactobacillus reuteri JCM 1112

Gene: LAR_0680: Chaperone protein DnaJ
 
Lactobacillus rhamnosus GG

Gene: LGG_01603: Chaperone protein DnaJ
 
Lactobacillus sakei subsp. sakei 23K

Gene: LSA1235: Chaperone protein DnaJ
 
Lactobacillus salivarius subsp. salivarius UCC118

Gene: LSL_0579: Chaperone protein DnaJ
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Gene: LEUM_1346: Chaperone protein DnaJ
 
Oenococcus oeni PSU-1

Gene: OEOE_1308: Chaperone protein DnaJ
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_0897: Chaperone protein DnaJ
Chaperone protein DnaJ
 
CRON 2.
groS
 
Lactobacillus acidophilus NCFM

Gene: LBA0405: Heat shock protein 60 family co-chaperone GroES
 
Lactobacillus brevis ATCC 367

Gene: LVIS_0617: Heat shock protein 60 family co-chaperone GroES
 
Lactobacillus casei ATCC 334

Gene: LSEI_2239: Heat shock protein 60 family co-chaperone GroES
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Gene: LBUL_1497: Heat shock protein 60 family co-chaperone GroES
*
Lactobacillus fermentum IFO 3956

Site:
position = -153
score = -0.638308
sequence = TTGGTCAAAATTAGTCAAAGTTTT

Gene: LAF_0325: Heat shock protein 60 family co-chaperone GroES
 
Lactobacillus helveticus DPC 4571

Gene: lhv_0425: Heat shock protein 60 family co-chaperone GroES
 
Lactobacillus johnsonii NCC 533

Gene: LJ0460: Heat shock protein 60 family co-chaperone GroES
 
Lactobacillus plantarum WCFS1

Gene: lp_0727: Heat shock protein 60 family co-chaperone GroES
*
Lactobacillus reuteri JCM 1112

Site:
position = -128
score = -1.14175
sequence = ATGGTCAAAAAAAGTCAAAGTGTT

Gene: LAR_0342: Heat shock protein 60 family co-chaperone GroES
 
Lactobacillus rhamnosus GG

Gene: LGG_02240: Heat shock protein 60 family co-chaperone GroES
 
Lactobacillus sakei subsp. sakei 23K

Gene: LSA0358: Heat shock protein 60 family co-chaperone GroES
 
Lactobacillus salivarius subsp. salivarius UCC118

Gene: LSL_1212: Heat shock protein 60 family co-chaperone GroES
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Gene: LEUM_1763: Heat shock protein 60 family co-chaperone GroES
*
Oenococcus oeni PSU-1

Site:
position = -72
score = 6.71498
sequence = AAAAGTTTGACCTTTTTTGACCAA

Gene: OEOE_1397: Heat shock protein 60 family co-chaperone GroES
*
Pediococcus pentosaceus ATCC 25745

Site:
position = -128
score = -0.872603
sequence = TTGGTTAATAAAGGTCAAAAATAC

Gene: PEPE_0420: Heat shock protein 60 family co-chaperone GroES
Heat shock protein 60 family co-chaperone GroES
groL
 
Lactobacillus acidophilus NCFM

Gene: LBA0406: Heat shock protein 60 family chaperone GroEL
 
Lactobacillus brevis ATCC 367

Gene: LVIS_0618: Heat shock protein 60 family chaperone GroEL
 
Lactobacillus casei ATCC 334

Gene: LSEI_2238: Heat shock protein 60 family chaperone GroEL
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Gene: LBUL_1496: Heat shock protein 60 family chaperone GroEL
 
Lactobacillus fermentum IFO 3956

Gene: LAF_0326: Heat shock protein 60 family chaperone GroEL
 
Lactobacillus helveticus DPC 4571

Gene: lhv_0426: Heat shock protein 60 family chaperone GroEL
 
Lactobacillus johnsonii NCC 533

Gene: LJ0461: Heat shock protein 60 family chaperone GroEL
 
Lactobacillus plantarum WCFS1

Gene: lp_0728: Heat shock protein 60 family chaperone GroEL
 
Lactobacillus reuteri JCM 1112

Gene: LAR_0343: Heat shock protein 60 family chaperone GroEL
 
Lactobacillus rhamnosus GG

Gene: LGG_02239: Heat shock protein 60 family chaperone GroEL
 
Lactobacillus sakei subsp. sakei 23K

Gene: LSA0359: Heat shock protein 60 family chaperone GroEL
 
Lactobacillus salivarius subsp. salivarius UCC118

Gene: LSL_1211: Heat shock protein 60 family chaperone GroEL
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Gene: LEUM_1762: Heat shock protein 60 family chaperone GroEL
 
Oenococcus oeni PSU-1

Gene: OEOE_1396: Heat shock protein 60 family chaperone GroEL
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_0421: Heat shock protein 60 family chaperone GroEL
Heat shock protein 60 family chaperone GroEL
 
CRON 3.
clpP
 
Lactobacillus acidophilus NCFM

Gene: LBA0694: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
*
Lactobacillus brevis ATCC 367

Site:
position = -90
score = 6.16577
sequence = TTTTGTTTGACCTACTCTGACCTT

Gene: LVIS_0654: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
*
Lactobacillus casei ATCC 334

Site:
position = -85
score = 7.04585
sequence = AAATCTTTGACCTTATTTGACTTT

Gene: LSEI_0963: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Gene: LBUL_0559: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
*
Lactobacillus fermentum IFO 3956

Site:
position = -90
score = 6.57105
sequence = AATGATTTGACCTTTTTTGACCTA

Gene: LAF_0360: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
 
Lactobacillus helveticus DPC 4571

Gene: lhv_0735: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
 
Lactobacillus johnsonii NCC 533

Gene: LJ0869: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
*
Lactobacillus plantarum WCFS1

Site:
position = -92
score = 5.77559
sequence = TTTCTTTTGACCTTCACTGACCTT

Gene: lp_0786: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
*
Lactobacillus reuteri JCM 1112

Site:
position = -93
score = 6.68814
sequence = AAACATTTGACCTTTTTTGACCAA

Gene: LAR_0379: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
*
Lactobacillus rhamnosus GG

Site:
position = -88
score = 7.04585
sequence = AAATCTTTGACCTTATTTGACTTT

Gene: LGG_00931: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
*
Lactobacillus sakei subsp. sakei 23K

Site:
position = -116
score = 6.02412
sequence = TACCATTTGACCATAGTTGACCTT

Gene: LSA0531: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
*
Lactobacillus salivarius subsp. salivarius UCC118

Site:
position = -101
score = 6.25078
sequence = TTAAATTTGACCATTATTGACCTT

Gene: LSL_1168: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
*
Oenococcus oeni PSU-1

Site:
position = -63
score = 6.73198
sequence = AAAAGTTTGACCTTTCTTGACCAT

Gene: OEOE_0570: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
*
Pediococcus pentosaceus ATCC 25745

Site:
position = -95
score = 6.86454
sequence = AAATATTTGACCTTTTTTGACCAA

Gene: PEPE_0455: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
 
CRON 4.
hsp
 
Lactobacillus acidophilus NCFM

Gene: LBA0205: Small heat shock protein
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334

Gene: LSEI_2800: Small heat shock protein
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Gene: LBUL_0243: Small heat shock protein
 
Lactobacillus fermentum IFO 3956

Gene: LAF_1369: Small heat shock protein
 
Lactobacillus helveticus DPC 4571

Gene: lhv_0222: Small heat shock protein
 
Lactobacillus johnsonii NCC 533

Gene: LJ0181: Small heat shock protein
 
Lactobacillus plantarum WCFS1

Gene: lp_0129: Small heat shock protein
 
Lactobacillus reuteri JCM 1112

Gene: LAR_1239: Small heat shock protein
 
Lactobacillus rhamnosus GG

Gene: LGG_02804: Small heat shock protein
 
Lactobacillus sakei subsp. sakei 23K

Gene: LSA0050: Small heat shock protein
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
*
Oenococcus oeni PSU-1

Site:
position = -96
score = 6.50893
sequence = TTTTATTTGACCTTTCTTGACTTT

Gene: OEOE_0289: Small heat shock protein
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_1643: Small heat shock protein
Small heat shock protein
 
CRON 5.
clpB
 
Lactobacillus acidophilus NCFM
*
Lactobacillus brevis ATCC 367

Site:
position = -139
score = -1.6359
sequence = TTGGTCAAAAAAGGTCAAATTATT

Gene: LVIS_0762: ATP-binding subunit of Clp protease and DnaK/DnaJ chaperones
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
*
Lactobacillus plantarum WCFS1

Site:
position = -118
score = 6.47827
sequence = AAATCCTTGACCTTGTTTGACCTT

Gene: lp_1903: ATP-binding subunit of Clp protease and DnaK/DnaJ chaperones
 
Lactobacillus reuteri JCM 1112
*
Lactobacillus rhamnosus GG

Site:
position = -73
score = 6.17843
sequence = AATAGTTTGACCTTAACTGACCAA

Gene: LGG_01367: ATP-binding subunit of Clp protease and DnaK/DnaJ chaperones
*
Lactobacillus sakei subsp. sakei 23K

Site:
position = -89
score = 6.53688
sequence = GAATGTTTGACCTATTTTGACTAT

Gene: LSA1040: ATP-binding subunit of Clp protease and DnaK/DnaJ chaperones
*
Lactobacillus salivarius subsp. salivarius UCC118

Site:
position = -75
score = -0.985392
sequence = AAGGTCAAACTTAGTCAAAGTTTA

Gene: LSL_0863: ATP-binding subunit of Clp protease and DnaK/DnaJ chaperones
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_1096: ATP-binding subunit of Clp protease and DnaK/DnaJ chaperones
ATP-binding subunit of Clp protease and DnaK/DnaJ chaperones
 
CRON 6.
ctsR
 
Lactobacillus acidophilus NCFM
*
Lactobacillus brevis ATCC 367

Site:
position = -45
score = -1.08473
sequence = TTAGTCAGCATTAGTCAAATAAGT

Gene: LVIS_1701: Stress and heat shock response transcriptional regulator CtsR, CtsR family
*
Lactobacillus casei ATCC 334

Site:
position = -39
score = -0.0397677
sequence = ATAGTCAAGATTGGTCAAAGTCAA

Gene: LSEI_2518: Stress and heat shock response transcriptional regulator CtsR, CtsR family
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956

Gene: LAF_1527: Stress and heat shock response transcriptional regulator CtsR, CtsR family
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
*
Lactobacillus plantarum WCFS1

Site:
position = -41
score = -0.277144
sequence = ATAGTCAATATTAGTCAAAGATAA

Gene: lp_1018: Stress and heat shock response transcriptional regulator CtsR, CtsR family
 
Lactobacillus reuteri JCM 1112

Gene: LAR_1405: Stress and heat shock response transcriptional regulator CtsR, CtsR family
*
Lactobacillus rhamnosus GG

Site:
position = -39
score = -0.0397677
sequence = ATAGTCAAGATTGGTCAAAGTCAA

Gene: LGG_02500: Stress and heat shock response transcriptional regulator CtsR, CtsR family
*
Lactobacillus sakei subsp. sakei 23K

Site:
position = -77
score = -0.816409
sequence = ATAGTCAACGTTAGTCAAAGTTAA

Gene: LSA1780: Stress and heat shock response transcriptional regulator CtsR, CtsR family
*
Lactobacillus salivarius subsp. salivarius UCC118

Site:
position = -42
score = -0.958259
sequence = AAAGTCAATGTAGGTCAAACCTAC

Gene: LSL_0195: Stress and heat shock response transcriptional regulator CtsR, CtsR family
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
*
Oenococcus oeni PSU-1

Site:
position = -21
score = -0.891367
sequence = TTAGTCAGGAATGGTCAAATTATG

Gene: OEOE_0513: Stress and heat shock response transcriptional regulator CtsR, CtsR family
*
Pediococcus pentosaceus ATCC 25745

Site:
position = -38
score = -0.616609
sequence = ATAGTCAACATTAGTCAGAGTATA

Gene: PEPE_1428: Stress and heat shock response transcriptional regulator CtsR, CtsR family
Stress and heat shock response transcriptional regulator CtsR, CtsR family
clpC
 
Lactobacillus acidophilus NCFM

Gene: LBA0283: ATP-dependent Clp protease ATP-binding subunit ClpC
 
Lactobacillus brevis ATCC 367

Gene: LVIS_1700: ATP-dependent Clp protease ATP-binding subunit ClpC
 
Lactobacillus casei ATCC 334

Gene: LSEI_2517: ATP-dependent Clp protease ATP-binding subunit ClpC
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Gene: LBUL_0339: ATP-dependent Clp protease ATP-binding subunit ClpC
 
Lactobacillus fermentum IFO 3956

Gene: LAF_1526: ATP-dependent Clp protease ATP-binding subunit ClpC
 
Lactobacillus helveticus DPC 4571

Gene: lhv_0301: ATP-dependent Clp protease ATP-binding subunit ClpC
 
Lactobacillus johnsonii NCC 533

Gene: LJ0331: ATP-dependent Clp protease ATP-binding subunit ClpC
 
Lactobacillus plantarum WCFS1

Gene: lp_1019: ATP-dependent Clp protease ATP-binding subunit ClpC
 
Lactobacillus reuteri JCM 1112

Gene: LAR_1404: ATP-dependent Clp protease ATP-binding subunit ClpC
 
Lactobacillus rhamnosus GG

Gene: LGG_02499: ATP-dependent Clp protease ATP-binding subunit ClpC
 
Lactobacillus sakei subsp. sakei 23K

Gene: LSA1779: ATP-dependent Clp protease ATP-binding subunit ClpC
 
Lactobacillus salivarius subsp. salivarius UCC118

Gene: LSL_0196: ATP-dependent Clp protease ATP-binding subunit ClpC
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Gene: LEUM_0185: ATP-dependent Clp protease ATP-binding subunit ClpC
 
Oenococcus oeni PSU-1

Gene: OEOE_0514: ATP-dependent Clp protease ATP-binding subunit ClpC
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_1427: ATP-dependent Clp protease ATP-binding subunit ClpC
ATP-dependent Clp protease ATP-binding subunit ClpC
 
CRON 7.
clpE
 
Lactobacillus acidophilus NCFM

Gene: LBA0638: ATP-dependent Clp protease, ATP-binding subunit ClpE
*
Lactobacillus brevis ATCC 367

Site:
position = -84
score = 0.606989
sequence = ATGGTCAAGAAAGGTCAAGCCTTT

Gene: LVIS_1554: ATP-dependent Clp protease, ATP-binding subunit ClpE
*
Lactobacillus casei ATCC 334

Site:
position = -198
score = 0.0981333
sequence = TAGGTCAAGAAAGGTCAAACCTTT

Gene: LSEI_1762: ATP-dependent Clp protease, ATP-binding subunit ClpE
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Gene: LBUL_0510: ATP-dependent Clp protease, ATP-binding subunit ClpE
*
Lactobacillus fermentum IFO 3956

Site:
position = -48
score = -0.667882
sequence = ATGGTCAAGAAAAGTCAAAGGTTG

Gene: LAF_1388: ATP-dependent Clp protease, ATP-binding subunit ClpE
 
Lactobacillus helveticus DPC 4571

Gene: lhv_0683: ATP-dependent Clp protease, ATP-binding subunit ClpE
 
Lactobacillus johnsonii NCC 533

Gene: LJ0815: ATP-dependent Clp protease, ATP-binding subunit ClpE
*
Lactobacillus plantarum WCFS1

Site:
position = -93
score = -2.25379
sequence = AAGGTCAACAAAGGTCAAAGAGCC

Gene: lp_1269: ATP-dependent Clp protease, ATP-binding subunit ClpE
*
Lactobacillus reuteri JCM 1112

Site:
position = -59
score = 0.175316
sequence = ATGGTCAAGAAAGGTCAAAACATT

Gene: LAR_1257: ATP-dependent Clp protease, ATP-binding subunit ClpE
*
Lactobacillus rhamnosus GG

Site:
position = -69
score = 0.0981333
sequence = TAGGTCAAGAAAGGTCAAACCTTT

Gene: LGG_01823: ATP-dependent Clp protease, ATP-binding subunit ClpE
*
Lactobacillus sakei subsp. sakei 23K

Site:
position = -66
score = -1.83873
sequence = AAGGTCAAAGATAGTCAAACAAAC

Gene: LSA1465: ATP-dependent Clp protease, ATP-binding subunit ClpE
*
Lactobacillus salivarius subsp. salivarius UCC118

Site:
position = -57
score = -1.61934
sequence = AAGGTCAAAGTTGGTCAAAATAAC

Gene: LSL_0386: ATP-dependent Clp protease, ATP-binding subunit ClpE
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Gene: LEUM_0571: ATP-dependent Clp protease, ATP-binding subunit ClpE
*
Oenococcus oeni PSU-1

Site:
position = -27
score = -1.34149
sequence = AAGGTCAATAAAGGTCAAACATTG

Gene: OEOE_0640: ATP-dependent Clp protease, ATP-binding subunit ClpE
*
Pediococcus pentosaceus ATCC 25745

Site:
position = -223
score = -1.46087
sequence = ATGGTCAATATTGGTCAAACATCA

Gene: PEPE_0607: ATP-dependent Clp protease, ATP-binding subunit ClpE
ATP-dependent Clp protease, ATP-binding subunit ClpE
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD