Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CtsR - Streptococcaceae

Properties
Regulator type: Transcription factor
Regulator family: CtsR
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 68 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Lactococcus lactis subsp. cremoris SK11 8 5
Lactococcus lactis subsp. lactis Il1403 8 5
Streptococcus agalactiae 2603V/R 7 5
Streptococcus dysgalactiae subsp. equisimilis GGS_124 5 4
Streptococcus equi subsp. zooepidemicus MGCS10565 7 5
Streptococcus gallolyticus UCN34 7 5
Streptococcus gordonii str. Challis substr. CH1 6 4
Streptococcus mitis B6 7 5
Streptococcus mutans UA159 4 3
Streptococcus pneumoniae TIGR4 7 5
Streptococcus pyogenes M1 GAS 7 5
Streptococcus sanguinis SK36 6 4
Streptococcus suis 05ZYH33 10 4
Streptococcus thermophilus CNRZ1066 7 5
Streptococcus uberis 0140J 5 4
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
clpB
*
Lactococcus lactis subsp. cremoris SK11

Site:
position = -98
score = 6.25715
sequence = AAAAGCTTGACCATTACTGACTAA

Gene: LACR_1612: ATP-binding subunit of Clp protease and DnaK/DnaJ chaperones
*
Lactococcus lactis subsp. lactis Il1403

Site:
position = -98
score = 6.52833
sequence = AAAAGTTTGACCATTACTGACCAA

Gene: L166407: ATP-binding subunit of Clp protease and DnaK/DnaJ chaperones
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
ATP-binding subunit of Clp protease and DnaK/DnaJ chaperones
 
CRON 2.
groS
*
Lactococcus lactis subsp. cremoris SK11

Site:
position = -95
score = 5.92574
sequence = TTTCTCTTGACTAAATCTGACCAT

Gene: LACR_0439: Heat shock protein 60 family co-chaperone GroES
*
Lactococcus lactis subsp. lactis Il1403

Site:
position = -96
score = 5.92574
sequence = TTTCTCTTGACTAAATCTGACCAT

Gene: L198515: Heat shock protein 60 family co-chaperone GroES
*
Streptococcus agalactiae 2603V/R

Site:
position = -109
score = 6.34428
sequence = TTTCTCTTGACTAATTCTGACCAA

Gene: SAG2075: Heat shock protein 60 family co-chaperone GroES
*
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Site:
position = -106
score = 6.86088
sequence = TTTTTCTTGACTATTTTTGACCAA

Gene: SDEG_2041: Heat shock protein 60 family co-chaperone GroES
*
Streptococcus equi subsp. zooepidemicus MGCS10565

Site:
position = -110
score = 6.86088
sequence = TTTTTCTTGACTATTTTTGACCAA

Gene: Sez_0145: Heat shock protein 60 family co-chaperone GroES
*
Streptococcus gallolyticus UCN34

Site:
position = -134
score = 6.76219
sequence = TTTTTCTTGACTATTTCTGACCAA

Gene: GALLO_0124: Heat shock protein 60 family co-chaperone GroES
*
Streptococcus gordonii str. Challis substr. CH1

Site:
position = -96
score = 6.86088
sequence = TTTTTCTTGACTATTTTTGACCAA

Gene: SGO_1886: Heat shock protein 60 family co-chaperone GroES
*
Streptococcus mitis B6

Site:
position = -102
score = 6.76219
sequence = TTTTTCTTGACTATTTCTGACCAA

Gene: smi_0481: Heat shock protein 60 family co-chaperone GroES
*
Streptococcus mutans UA159

Site:
position = -91
score = 6.86088
sequence = TTTTTCTTGACTATTTTTGACCAA

Gene: SMU.1955: Heat shock protein 60 family co-chaperone GroES
*
Streptococcus pneumoniae TIGR4

Site:
position = -102
score = 6.23751
sequence = TTTTTCTTGATTATTTCTGACCAA

Gene: SP_1907: Heat shock protein 60 family co-chaperone GroES
*
Streptococcus pyogenes M1 GAS

Site:
position = -107
score = 6.86088
sequence = TTTTTCTTGACTATTTTTGACCAA

Gene: SPy2072: Heat shock protein 60 family co-chaperone GroES
*
Streptococcus sanguinis SK36

Site:
position = -97
score = 6.76219
sequence = TTTTTCTTGACTATTTCTGACCAA

Gene: SSA_0225: Heat shock protein 60 family co-chaperone GroES
*
Streptococcus suis 05ZYH33

Site:
position = -66
score = 6.48664
sequence = ATGTTCTTGACTATTTTTGACCAA

Gene: SSU05_0147: Heat shock protein 60 family co-chaperone GroES
*
Streptococcus thermophilus CNRZ1066

Site:
position = -124
score = 6.6754
sequence = TTTTTCTTGACTATTTTTGACTAA

Gene: str0203: Heat shock protein 60 family co-chaperone GroES
*
Streptococcus uberis 0140J

Site:
position = -108
score = 6.59261
sequence = TTTTTCTTGACTAATTTTGACCAA

Gene: SUB1742: Heat shock protein 60 family co-chaperone GroES
Heat shock protein 60 family co-chaperone GroES
groL
 
Lactococcus lactis subsp. cremoris SK11

Gene: LACR_0440: Heat shock protein 60 family chaperone GroEL
 
Lactococcus lactis subsp. lactis Il1403

Gene: L198893: Heat shock protein 60 family chaperone GroEL
 
Streptococcus agalactiae 2603V/R

Gene: SAG2074: Heat shock protein 60 family chaperone GroEL
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_2040: Heat shock protein 60 family chaperone GroEL
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_0146: Heat shock protein 60 family chaperone GroEL
 
Streptococcus gallolyticus UCN34

Gene: GALLO_0125: Heat shock protein 60 family chaperone GroEL
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_1885: Heat shock protein 60 family chaperone GroEL
 
Streptococcus mitis B6

Gene: smi_0482: Heat shock protein 60 family chaperone GroEL
 
Streptococcus mutans UA159

Gene: SMU.1954: Heat shock protein 60 family chaperone GroEL
 
Streptococcus pneumoniae TIGR4

Gene: SP_1906: Heat shock protein 60 family chaperone GroEL
 
Streptococcus pyogenes M1 GAS

Gene: SPy2070: Heat shock protein 60 family chaperone GroEL
 
Streptococcus sanguinis SK36

Gene: SSA_0226: Heat shock protein 60 family chaperone GroEL
 2
Streptococcus suis 05ZYH33

Gene: SSU05_0148: Heat shock protein 60 family chaperone GroEL

Gene: SSU05_0149: Heat shock protein 60 family chaperone GroEL
 
Streptococcus thermophilus CNRZ1066

Gene: str0204: Heat shock protein 60 family chaperone GroEL
 
Streptococcus uberis 0140J

Gene: SUB1741: Heat shock protein 60 family chaperone GroEL
Heat shock protein 60 family chaperone GroEL
 
CRON 3.
ctsR
*
Lactococcus lactis subsp. cremoris SK11

Site:
position = -56
score = 0.423713
sequence = ATAGTCAGTAATAGTCAAAGATTA

Gene: LACR_0665: Stress and heat shock response transcriptional regulator CtsR, CtsR family
*
Lactococcus lactis subsp. lactis Il1403

Site:
position = -56
score = 0.423713
sequence = ATAGTCAGTAATAGTCAAAGATTA

Gene: L0223: Stress and heat shock response transcriptional regulator CtsR, CtsR family
*
Streptococcus agalactiae 2603V/R

Site:
position = -36
score = -0.674182
sequence = ATAGTCAGTTATAGTCAAAGAGGA

Gene: SAG1829: Stress and heat shock response transcriptional regulator CtsR, CtsR family
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_2043: Stress and heat shock response transcriptional regulator CtsR, CtsR family
*
Streptococcus equi subsp. zooepidemicus MGCS10565

Site:
position = -69
score = 0.792732
sequence = TTAGTCAGTTTTAGTCAAAAATAA

Gene: Sez_0139: Stress and heat shock response transcriptional regulator CtsR, CtsR family
*
Streptococcus gallolyticus UCN34

Site:
position = -66
score = -0.346024
sequence = ATAGTCAGTTATAGTCAAAGATAG

Gene: GALLO_2164: Stress and heat shock response transcriptional regulator CtsR, CtsR family
*
Streptococcus gordonii str. Challis substr. CH1

Site:
position = -110
score = 0.453539
sequence = TTAGTCAAAGATAGTCAATGTCAA

Gene: SGO_1999: Stress and heat shock response transcriptional regulator CtsR, CtsR family
*
Streptococcus mitis B6

Site:
position = -44
score = 0.423713
sequence = ATAGTCAAAGATAGTCAAGGTTTA

Gene: smi_2046: Stress and heat shock response transcriptional regulator CtsR, CtsR family
 
Streptococcus mutans UA159

Gene: SMU.2030: Stress and heat shock response transcriptional regulator CtsR, CtsR family
*
Streptococcus pneumoniae TIGR4

Site:
position = -44
score = -0.429284
sequence = ATAGTCAAACAAGGTCAAGGTTTA

Gene: SP_2195: Stress and heat shock response transcriptional regulator CtsR, CtsR family
*
Streptococcus pyogenes M1 GAS

Site:
position = -78
score = 0.112844
sequence = ATAGTCAGTTTTAGTCAAAATGTA

Gene: SPy2074: Stress and heat shock response transcriptional regulator CtsR, CtsR family
*
Streptococcus sanguinis SK36

Site:
position = -77
score = -0.221117
sequence = TTAGTCAAAGATAGTCAATGTTAG

Gene: SSA_2200: Stress and heat shock response transcriptional regulator CtsR, CtsR family
*
Streptococcus suis 05ZYH33

Site:
position = -34
score = -0.875808
sequence = ATGGTCAAAGATAGTCAAAGAAAG

Gene: SSU05_1976: Stress and heat shock response transcriptional regulator CtsR, CtsR family
*
Streptococcus thermophilus CNRZ1066

Site:
position = -38
score = -0.674182
sequence = ATAGTCAGTTATAGTCAAATTAGA

Gene: str0076: Stress and heat shock response transcriptional regulator CtsR, CtsR family
 
Streptococcus uberis 0140J

Gene: SUB1744: Stress and heat shock response transcriptional regulator CtsR, CtsR family
Stress and heat shock response transcriptional regulator CtsR, CtsR family
clpC
 
Lactococcus lactis subsp. cremoris SK11

Gene: LACR_0666: ATP-dependent Clp protease ATP-binding subunit ClpC
 
Lactococcus lactis subsp. lactis Il1403

Gene: L0222: ATP-dependent Clp protease ATP-binding subunit ClpC
 
Streptococcus agalactiae 2603V/R

Gene: SAG1828: ATP-dependent Clp protease ATP-binding subunit ClpC
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_2042: ATP-dependent Clp protease ATP-binding subunit ClpC
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_0140: ATP-dependent Clp protease ATP-binding subunit ClpC
 
Streptococcus gallolyticus UCN34

Gene: GALLO_2163: ATP-dependent Clp protease ATP-binding subunit ClpC
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_1998: ATP-dependent Clp protease ATP-binding subunit ClpC
 
Streptococcus mitis B6

Gene: smi_2045: ATP-dependent Clp protease ATP-binding subunit ClpC
 
Streptococcus mutans UA159

Gene: SMU.2029: ATP-dependent Clp protease ATP-binding subunit ClpC
 
Streptococcus pneumoniae TIGR4

Gene: SP_2194: ATP-dependent Clp protease ATP-binding subunit ClpC
 
Streptococcus pyogenes M1 GAS

Gene: SPy2073: ATP-dependent Clp protease ATP-binding subunit ClpC
 
Streptococcus sanguinis SK36

Gene: SSA_2199: ATP-dependent Clp protease ATP-binding subunit ClpC
 
Streptococcus suis 05ZYH33

Gene: SSU05_1975: ATP-dependent Clp protease ATP-binding subunit ClpC
 
Streptococcus thermophilus CNRZ1066

Gene: str0077: ATP-dependent Clp protease ATP-binding subunit ClpC
 
Streptococcus uberis 0140J

Gene: SUB1743: ATP-dependent Clp protease ATP-binding subunit ClpC
ATP-dependent Clp protease ATP-binding subunit ClpC
 
CRON 4.
clpL
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
*
Streptococcus agalactiae 2603V/R

Site:
position = -144
score = 6.29907
sequence = TATTTATTGACCTTTACTGACTAA

Gene: SAG1303: ATP-dependent Clp protease, ATP-binding subunit
*
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Site:
position = -180
score = 6.42288
sequence = TTTTGTTTGACCTTAACTGACCAA

Gene: SDEG_0851: ATP-dependent Clp protease, ATP-binding subunit
*
Streptococcus equi subsp. zooepidemicus MGCS10565

Site:
position = -181
score = 6.29035
sequence = TTTTGTTTGACCTTTACTGACCTT

Gene: Sez_1072: ATP-dependent Clp protease, ATP-binding subunit
*
Streptococcus gallolyticus UCN34

Site:
position = -190
score = 6.55594
sequence = AAATATTTGACTTTTACTGACCAA

Gene: GALLO_1249: ATP-dependent Clp protease, ATP-binding subunit
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_1856: ATP-dependent Clp protease, ATP-binding subunit
*
Streptococcus mitis B6

Site:
position = -276
score = 6.31165
sequence = AAATCCTTGACCTTTTCTGACTAA

Gene: smi_1765: ATP-dependent Clp protease, ATP-binding subunit
 
Streptococcus mutans UA159

Gene: SMU.956: ATP-dependent Clp protease, ATP-binding subunit
*
Streptococcus pneumoniae TIGR4

Site:
position = -275
score = 6.514
sequence = AAACTCTTGACCTTTTCTGACCAA

Gene: SP_0338: ATP-dependent Clp protease, ATP-binding subunit
*
Streptococcus pyogenes M1 GAS

Site:
position = -172
score = 6.29035
sequence = TTTTGTTTGACCTTTACTGACCTT

Gene: SPy0888: ATP-dependent Clp protease, ATP-binding subunit
 
Streptococcus sanguinis SK36

Gene: SSA_2096: ATP-dependent Clp protease, ATP-binding subunit
*3
Streptococcus suis 05ZYH33

Site:
position = -254
score = 6.14037
sequence = AAACTATTGACTTTTACTGACCAA

Gene: SSU05_0389: ATP-dependent Clp protease, ATP-binding subunit

Gene: SSU05_0390: ATP-dependent Clp protease, ATP-binding subunit

Gene: SSU05_0391: ATP-dependent Clp protease, ATP-binding subunit
*
Streptococcus thermophilus CNRZ1066

Site:
position = -84
score = -0.0822352
sequence = TTGGTCAGTAAAAGTCAATTTTTA

Gene: str1614: ATP-dependent Clp protease, ATP-binding subunit
*
Streptococcus uberis 0140J

Site:
position = -152
score = 6.88339
sequence = TTTTTCTTGACCTTTTTTGACCAA

Gene: SUB0776: ATP-dependent Clp protease, ATP-binding subunit
ATP-dependent Clp protease, ATP-binding subunit
 
CRON 5.
yffA
*
Lactococcus lactis subsp. cremoris SK11

Site:
position = -119
score = -0.38974
sequence = ATGGTCAAATATGGTCAAGCTTTT

Gene: LACR_0577: Hypothetical protein
*
Lactococcus lactis subsp. lactis Il1403

Site:
position = -117
score = -0.914416
sequence = ATGGTCAAATATGGTCAAACTTTT

Gene: L150017: Hypothetical protein
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Hypothetical protein
clpE
 
Lactococcus lactis subsp. cremoris SK11

Gene: LACR_0578: ATP-dependent Clp protease, ATP-binding subunit ClpE
 
Lactococcus lactis subsp. lactis Il1403

Gene: L0221: ATP-dependent Clp protease, ATP-binding subunit ClpE
*
Streptococcus agalactiae 2603V/R

Site:
position = -65
score = 6.25458
sequence = TAAAGTTTGACTATATTTGACTAT

Gene: SAG0488: ATP-dependent Clp protease, ATP-binding subunit ClpE
*
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Site:
position = -62
score = 6.71234
sequence = TAAAGTTTGACCATTTTTGACTAA

Gene: SDEG_1496: ATP-dependent Clp protease, ATP-binding subunit ClpE
*
Streptococcus equi subsp. zooepidemicus MGCS10565

Site:
position = -63
score = 6.71234
sequence = TAAAGTTTGACCATTTTTGACTAA

Gene: Sez_0605: ATP-dependent Clp protease, ATP-binding subunit ClpE
*
Streptococcus gallolyticus UCN34

Site:
position = -65
score = 5.69378
sequence = TGAAGTTTGACTATCTTTGACCTT

Gene: GALLO_0612: ATP-dependent Clp protease, ATP-binding subunit ClpE
*
Streptococcus gordonii str. Challis substr. CH1

Site:
position = -65
score = 6.8586
sequence = TAAAGTTTGACTATTTTTGACCAA

Gene: SGO_0688: ATP-dependent Clp protease, ATP-binding subunit ClpE
*
Streptococcus mitis B6

Site:
position = -62
score = 6.27038
sequence = TAGAATTTGACTATTTTTGACCTT

Gene: smi_0865: ATP-dependent Clp protease, ATP-binding subunit ClpE
*
Streptococcus mutans UA159

Site:
position = -74
score = 6.59844
sequence = TAAAGTTTGACCATTATTGACCAT

Gene: SMU.562: ATP-dependent Clp protease, ATP-binding subunit ClpE
*
Streptococcus pneumoniae TIGR4

Site:
position = -62
score = 6.27038
sequence = TAGAATTTGACTATTTTTGACCTT

Gene: SP_0820: ATP-dependent Clp protease, ATP-binding subunit ClpE
*
Streptococcus pyogenes M1 GAS

Site:
position = -62
score = 6.71234
sequence = TAAAGTTTGACCATTTTTGACTAA

Gene: SPy1509: ATP-dependent Clp protease, ATP-binding subunit ClpE
*
Streptococcus sanguinis SK36

Site:
position = -73
score = 6.20615
sequence = AAAACTTTGACTATTTTTGACCTT

Gene: SSA_0669: ATP-dependent Clp protease, ATP-binding subunit ClpE
 
Streptococcus suis 05ZYH33

Gene: SSU05_0492: ATP-dependent Clp protease, ATP-binding subunit ClpE
*
Streptococcus thermophilus CNRZ1066

Site:
position = -75
score = 6.52277
sequence = ATAGATTTGACCTTTTTTGACCAA

Gene: str0602: ATP-dependent Clp protease, ATP-binding subunit ClpE
*
Streptococcus uberis 0140J

Site:
position = -61
score = 6.71234
sequence = TAAAGTTTGACCATTTTTGACTAA

Gene: SUB1281: ATP-dependent Clp protease, ATP-binding subunit ClpE
ATP-dependent Clp protease, ATP-binding subunit ClpE
 
CRON 6.
clpP
*
Lactococcus lactis subsp. cremoris SK11

Site:
position = -110
score = 6.80258
sequence = TTTTCTTTGACCTTTTTTGACCAA

Gene: LACR_0700: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
*
Lactococcus lactis subsp. lactis Il1403

Site:
position = -110
score = 6.83684
sequence = TATTCTTTGACCTTTTTTGACCAA

Gene: L72391: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
*
Streptococcus agalactiae 2603V/R

Site:
position = -67
score = 6.6062
sequence = TATTATTTGACCTTTGTTGACCAA

Gene: SAG1585: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
*
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Site:
position = -125
score = 6.45657
sequence = TATCATTTGACCTTTCTTGACCAA

Gene: SDEG_0439: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
*
Streptococcus equi subsp. zooepidemicus MGCS10565

Site:
position = -93
score = 6.84544
sequence = TATCATTTGACCTTTTTTGACCAA

Gene: Sez_1614: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
*
Streptococcus gallolyticus UCN34

Site:
position = -127
score = 6.96082
sequence = TTTTATTTGACCTTTTTTGACCAA

Gene: GALLO_1763: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
*
Streptococcus gordonii str. Challis substr. CH1

Site:
position = -103
score = 6.63859
sequence = AAAAATTTGACCTTTATTGACCAA

Gene: SGO_1632: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
*
Streptococcus mitis B6

Site:
position = -89
score = 6.78449
sequence = AAAAATTTGACCTTTTTTGACCAA

Gene: smi_1417: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
*
Streptococcus mutans UA159

Site:
position = -68
score = 6.83975
sequence = AAATATTTGACCTTTTTTGACCAA

Gene: SMU.1672: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
*
Streptococcus pneumoniae TIGR4

Site:
position = -89
score = 6.78449
sequence = AAAAATTTGACCTTTTTTGACCAA

Gene: SP_0746: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
*
Streptococcus pyogenes M1 GAS

Site:
position = -125
score = 6.56646
sequence = TATGATTTGACCTTTATTGACCAA

Gene: SPy0395: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
*
Streptococcus sanguinis SK36

Site:
position = -103
score = 6.61783
sequence = TTCTATTTGACCTTTTTTGACCAA

Gene: SSA_1731: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
*2
Streptococcus suis 05ZYH33

Site:
position = -67
score = 6.10436
sequence = TTTTTATTGACCAATTTTGACTAT

Gene: SSU05_1551: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)

Gene: SSU05_1550: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
*
Streptococcus thermophilus CNRZ1066

Site:
position = -67
score = 6.242
sequence = TTTTATTTGACCTAATTTGACTAA

Gene: str0356: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
*
Streptococcus uberis 0140J

Site:
position = -98
score = 6.73002
sequence = TATTATTTGACCTTATTTGACCAA

Gene: SUB0429: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD