Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog FruR - Lactobacillaceae

Properties
Regulator type: Transcription factor
Regulator family: DeoR
Regulation mode: repressor
Biological process: Fructose utilization
Effector: Fructose-6-phosphate
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 18 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Lactobacillus acidophilus NCFM 3 1
Lactobacillus brevis ATCC 367
Lactobacillus casei ATCC 334 3 1
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 3 1
Lactobacillus fermentum IFO 3956
Lactobacillus helveticus DPC 4571 3 1
Lactobacillus johnsonii NCC 533 3 1
Lactobacillus plantarum WCFS1 3 1
Lactobacillus reuteri JCM 1112
Lactobacillus rhamnosus GG 3 1
Lactobacillus sakei subsp. sakei 23K 3 1
Lactobacillus salivarius subsp. salivarius UCC118 3 1
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
Oenococcus oeni PSU-1
Pediococcus pentosaceus ATCC 25745 3 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
fruR
*
Lactobacillus acidophilus NCFM

Site:
position = -52
score = 4.54973
sequence = TGGTTGATTTTGATGGAGAA

Site:
position = -62
score = 4.53617
sequence = TGAAGAAAAATGGTTGATTT

Gene: LBA1779: Fructose utilization transcriptional regulator FruR, DeoR family
 
Lactobacillus brevis ATCC 367
*
Lactobacillus casei ATCC 334

Site:
position = -82
score = 5.14286
sequence = TGACAGTTGTTGAATGTTTT

Site:
position = -72
score = 5.94695
sequence = TGAATGTTTTTGCACGTTTT

Gene: LSEI_1349: Fructose utilization transcriptional regulator FruR, DeoR family
*
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Site:
position = -189
score = 4.57238
sequence = TGACGGAAAATGATTGCTTT

Gene: LBUL_1889: Fructose utilization transcriptional regulator FruR, DeoR family
 
Lactobacillus fermentum IFO 3956
*
Lactobacillus helveticus DPC 4571

Site:
position = -13
score = 5.83636
sequence = TGAATAAATATGATTGATTT

Site:
position = -3
score = 5.18472
sequence = TGATTGATTTTGAAAGAGAA

Gene: lhv_1846: Fructose utilization transcriptional regulator FruR, DeoR family
*
Lactobacillus johnsonii NCC 533

Site:
position = -95
score = 5.26174
sequence = TGACTAATATTGAATGAATA

Site:
position = -85
score = 6.15816
sequence = TGAATGAATATGAATGATTT

Gene: LJ0570: Fructose utilization transcriptional regulator FruR, DeoR family
*
Lactobacillus plantarum WCFS1

Site:
position = -82
score = 5.21032
sequence = TGGATTATTTTGACGGTTTT

Site:
position = -72
score = 5.74112
sequence = TGACGGTTTTTGAAGGTTTT

Gene: lp_2095: Fructose utilization transcriptional regulator FruR, DeoR family
 
Lactobacillus reuteri JCM 1112
*
Lactobacillus rhamnosus GG

Site:
position = -72
score = 5.64535
sequence = TGAATGTTTTTAACGGTTTT

Gene: LGG_01361: Fructose utilization transcriptional regulator FruR, DeoR family
*
Lactobacillus sakei subsp. sakei 23K

Site:
position = -83
score = 6.10574
sequence = TGATTGTTTTTGAACGTTTT

Site:
position = -73
score = 5.37591
sequence = TGAACGTTTTTGAAATATTT

Gene: LSA1048: Fructose utilization transcriptional regulator FruR, DeoR family
*
Lactobacillus salivarius subsp. salivarius UCC118

Site:
position = -71
score = 5.04614
sequence = TGATTTTTTTTGACTATTTA

Site:
position = -61
score = 5.66317
sequence = TGACTATTTATGATTGAATT

Gene: LSL_0163: Fructose utilization transcriptional regulator FruR, DeoR family
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
*
Pediococcus pentosaceus ATCC 25745

Site:
position = -73
score = 5.87642
sequence = TGAATTTTTTTGAATTAATT

Site:
position = -63
score = 6.06563
sequence = TGAATTAATTTGATTGATTT

Gene: PEPE_1166: Fructose utilization transcriptional regulator FruR, DeoR family
Fructose utilization transcriptional regulator FruR, DeoR family
fruB
 
Lactobacillus acidophilus NCFM

Gene: LBA1778: 1-phosphofructokinase (EC 2.7.1.56)
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334

Gene: LSEI_1348: 1-phosphofructokinase (EC 2.7.1.56)
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Gene: LBUL_1888: 1-phosphofructokinase (EC 2.7.1.56)
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571

Gene: lhv_1845: 1-phosphofructokinase (EC 2.7.1.56)
 
Lactobacillus johnsonii NCC 533

Gene: LJ0571: 1-phosphofructokinase (EC 2.7.1.56)
 
Lactobacillus plantarum WCFS1

Gene: lp_2096: 1-phosphofructokinase (EC 2.7.1.56)
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG

Gene: LGG_01360: 1-phosphofructokinase (EC 2.7.1.56)
 
Lactobacillus sakei subsp. sakei 23K

Gene: LSA1049: 1-phosphofructokinase (EC 2.7.1.56)
 
Lactobacillus salivarius subsp. salivarius UCC118

Gene: LSL_0164: 1-phosphofructokinase (EC 2.7.1.56)
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_1165: 1-phosphofructokinase (EC 2.7.1.56)
1-phosphofructokinase (EC 2.7.1.56)
fruA
 
Lactobacillus acidophilus NCFM

Gene: LBA1777: Fructose-specific PTS, EIIABC component (EC 2.7.1.69)
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334

Gene: LSEI_1347: Fructose-specific PTS, EIIABC component (EC 2.7.1.69)
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Gene: LBUL_1887: Fructose-specific PTS, EIIABC component (EC 2.7.1.69)
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571

Gene: lhv_1844: Fructose-specific PTS, EIIABC component (EC 2.7.1.69)
 
Lactobacillus johnsonii NCC 533

Gene: LJ0572: Fructose-specific PTS, EIIABC component (EC 2.7.1.69)
 
Lactobacillus plantarum WCFS1

Gene: lp_2097: Fructose-specific PTS, EIIABC component (EC 2.7.1.69)
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG

Gene: LGG_01359: Fructose-specific PTS, EIIABC component (EC 2.7.1.69)
 
Lactobacillus sakei subsp. sakei 23K

Gene: LSA1050: Fructose-specific PTS, EIIABC component (EC 2.7.1.69)
 
Lactobacillus salivarius subsp. salivarius UCC118

Gene: LSL_0165: Fructose-specific PTS, EIIABC component (EC 2.7.1.69)
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_1164: Fructose-specific PTS, EIIABC component (EC 2.7.1.69)
Fructose-specific PTS, EIIABC component (EC 2.7.1.69)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD