Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog FruR - Streptococcaceae

Properties
Regulator type: Transcription factor
Regulator family: DeoR
Regulation mode: repressor
Biological process: Fructose utilization
Effector: Fructose-6-phosphate
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 34 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Lactococcus lactis subsp. cremoris SK11 3 1
Lactococcus lactis subsp. lactis Il1403 3 1
Streptococcus agalactiae 2603V/R 3 1
Streptococcus dysgalactiae subsp. equisimilis GGS_124 3 1
Streptococcus equi subsp. zooepidemicus MGCS10565 3 1
Streptococcus gallolyticus UCN34 3 1
Streptococcus gordonii str. Challis substr. CH1 3 1
Streptococcus mitis B6 3 1
Streptococcus mutans UA159 3 1
Streptococcus pneumoniae TIGR4 3 1
Streptococcus pyogenes M1 GAS 3 1
Streptococcus sanguinis SK36 3 1
Streptococcus suis 05ZYH33 4 1
Streptococcus thermophilus CNRZ1066 8 1
Streptococcus uberis 0140J 3 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
fruR
*
Lactococcus lactis subsp. cremoris SK11

Site:
position = -82
score = 5.43813
sequence = TGAAAGAAAATGATAGTTAA

Site:
position = -62
score = 5.29229
sequence = TGATTGATTTTGATAGGTAA

Site:
position = -72
score = 5.7768
sequence = TGATAGTTAATGATTGATTT

Gene: LACR_1031: Fructose utilization transcriptional regulator FruR, DeoR family
*
Lactococcus lactis subsp. lactis Il1403

Site:
position = -72
score = 5.7768
sequence = TGATAGTTAATGATTGATTT

Site:
position = -62
score = 5.51942
sequence = TGATTGATTTTGAAAGATAA

Site:
position = -82
score = 5.21609
sequence = TGGAAGAAAATGATAGTTAA

Gene: L0031: Fructose utilization transcriptional regulator FruR, DeoR family
*
Streptococcus agalactiae 2603V/R

Site:
position = -85
score = 4.99347
sequence = TGATAGTTTTTGGAAGAAAA

Site:
position = -75
score = 5.79259
sequence = TGGAAGAAAATGCTTGACAT

Gene: SAG1348: Fructose utilization transcriptional regulator FruR, DeoR family
*
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Site:
position = -106
score = 5.73748
sequence = TGGAAGATTATGCTTGACTT

Gene: SDEG_0811: Fructose utilization transcriptional regulator FruR, DeoR family
*
Streptococcus equi subsp. zooepidemicus MGCS10565

Site:
position = -107
score = 5.802
sequence = TGAAAGATAGTGCTTGACTT

Site:
position = -117
score = 4.85609
sequence = TGAATGTTTTTGAAAGATAG

Gene: Sez_1106: Fructose utilization transcriptional regulator FruR, DeoR family
*
Streptococcus gallolyticus UCN34

Site:
position = -76
score = 6.12918
sequence = TGATAGAAAATGCTTGACAA

Site:
position = -86
score = 5.9807
sequence = TGATAGAATTTGATAGAAAA

Site:
position = -96
score = 4.84193
sequence = TGAAAAAACTTGATAGAATT

Gene: GALLO_1319: Fructose utilization transcriptional regulator FruR, DeoR family
*
Streptococcus gordonii str. Challis substr. CH1

Site:
position = -73
score = 5.98707
sequence = TGAAAGAAAATGCTTGACTT

Site:
position = -83
score = 5.8737
sequence = TGATAGAAAATGAAAGAAAA

Gene: SGO_1111: Fructose utilization transcriptional regulator FruR, DeoR family
*
Streptococcus mitis B6

Site:
position = -73
score = 5.54282
sequence = TGATAAAAAATGCTTGACTT

Site:
position = -83
score = 5.38253
sequence = TGAAAGAAAATGATAAAAAA

Site:
position = -93
score = 5.79851
sequence = TGATAGATTTTGAAAGAAAA

Gene: smi_1359: Fructose utilization transcriptional regulator FruR, DeoR family
*
Streptococcus mutans UA159

Site:
position = -25
score = 5.63818
sequence = TGGTAGAAATTGCTTGACAG

Site:
position = -35
score = 5.28107
sequence = TGGTAGAATTTGGTAGAAAT

Gene: SMU.870: Fructose utilization transcriptional regulator FruR, DeoR family
*
Streptococcus pneumoniae TIGR4

Site:
position = -73
score = 5.54282
sequence = TGATAAAAAATGCTTGACTT

Site:
position = -93
score = 5.79851
sequence = TGATAGATTTTGAAAGAAAA

Site:
position = -83
score = 5.38253
sequence = TGAAAGAAAATGATAAAAAA

Gene: SP_0875: Fructose utilization transcriptional regulator FruR, DeoR family
*
Streptococcus pyogenes M1 GAS

Site:
position = -103
score = 5.95951
sequence = TGAAAGATTATGCTTGACTT

Site:
position = -113
score = 5.81931
sequence = TGATAGATTTTGAAAGATTA

Site:
position = -123
score = 5.77946
sequence = TGGTAGAATTTGATAGATTT

Gene: SPy0853: Fructose utilization transcriptional regulator FruR, DeoR family
*
Streptococcus sanguinis SK36

Site:
position = -74
score = 5.94411
sequence = TGATAGAAAGTGCTTGACAT

Site:
position = -84
score = 5.09534
sequence = TGGAAGTTTTTGATAGAAAG

Gene: SSA_1080: Fructose utilization transcriptional regulator FruR, DeoR family
*
Streptococcus suis 05ZYH33

Site:
position = -42
score = 5.94134
sequence = TGAAAGAAAATGATAGAAAA

Site:
position = -32
score = 6.1847
sequence = TGATAGAAAATGATTGACAA

Gene: SSU05_0822: Fructose utilization transcriptional regulator FruR, DeoR family
*
Streptococcus thermophilus CNRZ1066

Site:
position = -92
score = 4.24532
sequence = TGAAATATTTTGATTTTTTT

Gene: str0399: Fructose utilization transcriptional regulator FruR, DeoR family
*
Streptococcus uberis 0140J

Site:
position = -105
score = 5.889
sequence = TGATAGATTGTGCTTGACTT

Site:
position = -115
score = 5.7408
sequence = TGAAAGAAAATGATAGATTG

Gene: SUB0748: Fructose utilization transcriptional regulator FruR, DeoR family
Fructose utilization transcriptional regulator FruR, DeoR family
fruB
 
Lactococcus lactis subsp. cremoris SK11

Gene: LACR_1032: 1-phosphofructokinase (EC 2.7.1.56)
 
Lactococcus lactis subsp. lactis Il1403

Gene: L0032: 1-phosphofructokinase (EC 2.7.1.56)
 
Streptococcus agalactiae 2603V/R

Gene: SAG1347: 1-phosphofructokinase (EC 2.7.1.56)
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_0812: 1-phosphofructokinase (EC 2.7.1.56)
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_1105: 1-phosphofructokinase (EC 2.7.1.56)
 
Streptococcus gallolyticus UCN34

Gene: GALLO_1318: 1-phosphofructokinase (EC 2.7.1.56)
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_1112: 1-phosphofructokinase (EC 2.7.1.56)
 
Streptococcus mitis B6

Gene: smi_1358: 1-phosphofructokinase (EC 2.7.1.56)
 
Streptococcus mutans UA159

Gene: SMU.871: 1-phosphofructokinase (EC 2.7.1.56)
 
Streptococcus pneumoniae TIGR4

Gene: SP_0876: 1-phosphofructokinase (EC 2.7.1.56)
 
Streptococcus pyogenes M1 GAS

Gene: SPy0854: 1-phosphofructokinase (EC 2.7.1.56)
 
Streptococcus sanguinis SK36

Gene: SSA_1081: 1-phosphofructokinase (EC 2.7.1.56)
 
Streptococcus suis 05ZYH33

Gene: SSU05_0823: 1-phosphofructokinase (EC 2.7.1.56)
 
Streptococcus thermophilus CNRZ1066

Gene: str0400: 1-phosphofructokinase (EC 2.7.1.56)
 
Streptococcus uberis 0140J

Gene: SUB0749: 1-phosphofructokinase (EC 2.7.1.56)
1-phosphofructokinase (EC 2.7.1.56)
fruA
 
Lactococcus lactis subsp. cremoris SK11

Gene: LACR_1033: Fructose-specific PTS, EIIABC component (EC 2.7.1.69)
 
Lactococcus lactis subsp. lactis Il1403

Gene: L185031: Fructose-specific PTS, EIIABC component (EC 2.7.1.69)
 
Streptococcus agalactiae 2603V/R

Gene: SAG1346: Fructose-specific PTS, EIIABC component (EC 2.7.1.69)
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_0813: Fructose-specific PTS, EIIABC component (EC 2.7.1.69)
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_1104: Fructose-specific PTS, EIIABC component (EC 2.7.1.69)
 
Streptococcus gallolyticus UCN34

Gene: GALLO_1317: Fructose-specific PTS, EIIABC component (EC 2.7.1.69)
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_1113: Fructose-specific PTS, EIIABC component (EC 2.7.1.69)
 
Streptococcus mitis B6

Gene: smi_1357: Fructose-specific PTS, EIIABC component (EC 2.7.1.69)
 
Streptococcus mutans UA159

Gene: SMU.872: Fructose-specific PTS, EIIABC component (EC 2.7.1.69)
 
Streptococcus pneumoniae TIGR4

Gene: SP_0877: Fructose-specific PTS, EIIABC component (EC 2.7.1.69)
 
Streptococcus pyogenes M1 GAS

Gene: SPy0855: Fructose-specific PTS, EIIABC component (EC 2.7.1.69)
 
Streptococcus sanguinis SK36

Gene: SSA_1082: Fructose-specific PTS, EIIABC component (EC 2.7.1.69)
 2
Streptococcus suis 05ZYH33

Gene: SSU05_0824: Fructose-specific PTS, EIIABC component (EC 2.7.1.69)

Gene: SSU05_0825: Fructose-specific PTS, EIIABC component (EC 2.7.1.69)
 6
Streptococcus thermophilus CNRZ1066

Gene: str0407: Fructose-specific PTS, EIIABC component (EC 2.7.1.69)

Gene: str0401: Fructose-specific PTS, EIIABC component (EC 2.7.1.69)

Gene: str0404: Fructose-specific PTS, EIIABC component (EC 2.7.1.69)

Gene: str0405: Fructose-specific PTS, EIIABC component (EC 2.7.1.69)

Gene: str0402: Fructose-specific PTS, EIIABC component (EC 2.7.1.69)

Gene: str0403: Fructose-specific PTS, EIIABC component (EC 2.7.1.69)
 
Streptococcus uberis 0140J

Gene: SUB0750: Fructose-specific PTS, EIIABC component (EC 2.7.1.69)
Fructose-specific PTS, EIIABC component (EC 2.7.1.69)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD