Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Crp - Bacteroidaceae

Properties
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: activator
Biological process:
Effector:
Phylum: Bacteroidetes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 113 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bacteroides cellulosilyticus DSM 14838 31 11
Bacteroides coprophilus DSM 18228 3 3
Bacteroides dorei DSM 17855 24 10
Bacteroides eggerthii DSM 20697 26 11
Bacteroides fragilis NCTC 9343 26 11
Bacteroides ovatus ATCC 8483 31 11
Bacteroides plebeius DSM 17135 13 4
Bacteroides stercoris ATCC 43183 15 9
Bacteroides thetaiotaomicron VPI-5482 39 13
Bacteroides uniformis ATCC 8492 30 12
Bacteroides vulgatus ATCC 8482 24 10
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
xylR
*
Bacteroides cellulosilyticus DSM 14838

Site:
position = -83
score = 4.8625
sequence = AATAGTGCTTTATAACATAATA

Gene: BACCELL_04758: Predicted regulator of xylose utilization, NrtR family
 
Bacteroides coprophilus DSM 18228
*
Bacteroides dorei DSM 17855

Site:
position = -34
score = 4.79014
sequence = AATAGTGTTTTAGAACATAATA

Gene: BACDOR_00865: Predicted regulator of xylose utilization, NrtR family
*
Bacteroides eggerthii DSM 20697

Site:
position = -92
score = 4.77237
sequence = AATAATGCTTTGTAACATATCA

Gene: BACEGG_02642: Predicted regulator of xylose utilization, NrtR family
*
Bacteroides fragilis NCTC 9343

Site:
position = -81
score = 4.56893
sequence = AACAATGCTTTATAGCATATTA

Gene: BF2354: Predicted regulator of xylose utilization, NrtR family
*
Bacteroides ovatus ATCC 8483

Site:
position = -80
score = 4.20374
sequence = AACAATGTTTTATAGCATGTTT

Gene: BACOVA_02532: Predicted regulator of xylose utilization, NrtR family
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_02263: Predicted regulator of xylose utilization, NrtR family
*
Bacteroides stercoris ATCC 43183

Site:
position = -92
score = 4.27792
sequence = AATAATGCTTTATAACATTGTA

Gene: BACSTE_01380: Predicted regulator of xylose utilization, NrtR family
*
Bacteroides thetaiotaomicron VPI-5482

Site:
position = -81
score = 4.23108
sequence = AACAATGTTTTATAGCATGTCA

Gene: BT0791: Predicted regulator of xylose utilization, NrtR family
*
Bacteroides uniformis ATCC 8492

Site:
position = -92
score = 4.09714
sequence = AATAATGCTTTATAATATTATA

Gene: BACUNI_00695: Predicted regulator of xylose utilization, NrtR family
*
Bacteroides vulgatus ATCC 8482

Site:
position = -100
score = 4.54006
sequence = AATAGTGTTTTGGAACATAATA

Gene: BVU_3955: Predicted regulator of xylose utilization, NrtR family
Predicted regulator of xylose utilization, NrtR family
xylB
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_04759: Xylulose kinase (EC 2.7.1.17)
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855

Gene: BACDOR_00866: Xylulose kinase (EC 2.7.1.17)
 
Bacteroides eggerthii DSM 20697

Gene: BACEGG_02643: Xylulose kinase (EC 2.7.1.17)
 
Bacteroides fragilis NCTC 9343

Gene: BF2355: Xylulose kinase (EC 2.7.1.17)
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_02533: Xylulose kinase (EC 2.7.1.17)
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_02264: Xylulose kinase (EC 2.7.1.17)
 
Bacteroides stercoris ATCC 43183

Gene: BACSTE_01381: Xylulose kinase (EC 2.7.1.17)
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT0792: Xylulose kinase (EC 2.7.1.17)
 
Bacteroides uniformis ATCC 8492

Gene: BACUNI_00694: Xylulose kinase (EC 2.7.1.17)
 
Bacteroides vulgatus ATCC 8482

Gene: BVU_3954: Xylulose kinase (EC 2.7.1.17)
Xylulose kinase (EC 2.7.1.17)
xylA
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_04760: Xylose isomerase (EC 5.3.1.5)
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855

Gene: BACDOR_00867: Xylose isomerase (EC 5.3.1.5)
 
Bacteroides eggerthii DSM 20697

Gene: BACEGG_02644: Xylose isomerase (EC 5.3.1.5)
 
Bacteroides fragilis NCTC 9343

Gene: BF2356: Xylose isomerase (EC 5.3.1.5)
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_02534: Xylose isomerase (EC 5.3.1.5)
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_02265: Xylose isomerase (EC 5.3.1.5)
 
Bacteroides stercoris ATCC 43183

Gene: BACSTE_01383: Xylose isomerase (EC 5.3.1.5)
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT0793: Xylose isomerase (EC 5.3.1.5)
 
Bacteroides uniformis ATCC 8492

Gene: BACUNI_00693: Xylose isomerase (EC 5.3.1.5)
 
Bacteroides vulgatus ATCC 8482

Gene: BVU_3953: Xylose isomerase (EC 5.3.1.5)
Xylose isomerase (EC 5.3.1.5)
xylE
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_04761: D-xylose proton-symporter XylE
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855

Gene: BACDOR_00759: D-xylose proton-symporter XylE
 
Bacteroides eggerthii DSM 20697

Gene: BACEGG_02645: D-xylose proton-symporter XylE
 
Bacteroides fragilis NCTC 9343

Gene: BF2357: D-xylose proton-symporter XylE
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_02535: D-xylose proton-symporter XylE
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_02266: D-xylose proton-symporter XylE
 
Bacteroides stercoris ATCC 43183

Gene: BACSTE_01384: D-xylose proton-symporter XylE
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT0794: D-xylose proton-symporter XylE
 
Bacteroides uniformis ATCC 8492

Gene: BACUNI_00692: D-xylose proton-symporter XylE
 
Bacteroides vulgatus ATCC 8482

Gene: BVU_4073: D-xylose proton-symporter XylE
D-xylose proton-symporter XylE
 
CRON 2.
nupG
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_03457: Nucleoside permease NupG
 
Bacteroides coprophilus DSM 18228

Gene: BACCOPRO_00774: Nucleoside permease NupG
 
Bacteroides dorei DSM 17855

Gene: BACDOR_01556: Nucleoside permease NupG
*
Bacteroides eggerthii DSM 20697

Site:
position = -193
score = 5.82074
sequence = GACTATGTTATATAACATAAAA

Gene: BACEGG_01333: Nucleoside permease NupG
 
Bacteroides fragilis NCTC 9343

Gene: BF0944: Nucleoside permease NupG
*
Bacteroides ovatus ATCC 8483

Site:
position = -269
score = 5.63672
sequence = CATTATGTTGTATAACATAAAC

Gene: BACOVA_05132: Nucleoside permease NupG
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_01143: Nucleoside permease NupG
*
Bacteroides stercoris ATCC 43183

Site:
position = -230
score = 5.67212
sequence = CATTATGTTTTATAACATAAAT

Gene: BACSTE_03522: Nucleoside permease NupG
*
Bacteroides thetaiotaomicron VPI-5482

Site:
position = -271
score = 5.73915
sequence = CATTATGTTCTATAACATAAAA

Gene: BT4330: Nucleoside permease NupG
*
Bacteroides uniformis ATCC 8492

Site:
position = -245
score = 5.03377
sequence = CAGCATGTTATATAACATAAAC

Gene: BACUNI_01546: Nucleoside permease NupG
 
Bacteroides vulgatus ATCC 8482

Gene: BVU_3613: Nucleoside permease NupG
Nucleoside permease NupG
 
CRON 3.
serB
*
Bacteroides cellulosilyticus DSM 14838

Site:
position = -163
score = 5.4883
sequence = TTTCATGTTATATAACATGTTT

Gene: BACCELL_04825: Phosphoserine phosphatase (EC 3.1.3.3)
*
Bacteroides coprophilus DSM 18228

Site:
position = -134
score = 5.5879
sequence = AATTATGCTTTTAAACATAAAT

Gene: BACCOPRO_01694: Phosphoserine phosphatase (EC 3.1.3.3)
*
Bacteroides dorei DSM 17855

Site:
position = -116
score = 6.05616
sequence = AAATATGTTATATAGCATAAAA

Gene: BACDOR_02848: Phosphoserine phosphatase (EC 3.1.3.3)
*
Bacteroides eggerthii DSM 20697

Site:
position = -74
score = 6.34032
sequence = TTTTATGTTATTTAGCATAAAA

Gene: BACEGG_02676: Phosphoserine phosphatase (EC 3.1.3.3)
*
Bacteroides fragilis NCTC 9343

Site:
position = -71
score = 6.18331
sequence = TTTTATGTTATTTAGCATAAAT

Gene: BF2389: Phosphoserine phosphatase (EC 3.1.3.3)
*
Bacteroides ovatus ATCC 8483

Site:
position = -66
score = 6.34032
sequence = TTTTATGTTATTTAGCATAAAA

Gene: BACOVA_02567: Phosphoserine phosphatase (EC 3.1.3.3)
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_00754: Phosphoserine phosphatase (EC 3.1.3.3)
*
Bacteroides stercoris ATCC 43183

Site:
position = -74
score = 6.34032
sequence = TTTTATGTTATTTAGCATAAAA

Gene: BACSTE_01424: Phosphoserine phosphatase (EC 3.1.3.3)
*
Bacteroides thetaiotaomicron VPI-5482

Site:
position = -67
score = 6.34032
sequence = TTTTATGTTATTTAGCATAAAA

Gene: BT0832: Phosphoserine phosphatase (EC 3.1.3.3)
*
Bacteroides uniformis ATCC 8492

Site:
position = -75
score = 6.18331
sequence = TTTTATGTTATTTAGCATAAAT

Gene: BACUNI_00649: Phosphoserine phosphatase (EC 3.1.3.3)
*
Bacteroides vulgatus ATCC 8482

Site:
position = -116
score = 6.05616
sequence = AAATATGTTATATAGCATAAAA

Gene: BVU_3158: Phosphoserine phosphatase (EC 3.1.3.3)
Phosphoserine phosphatase (EC 3.1.3.3)
 
CRON 4.
PF01694
*
Bacteroides cellulosilyticus DSM 14838

Site:
position = -196
score = 5.03588
sequence = TAATATGTTACACAAAAGATAT

Site:
position = -62
score = 5.79697
sequence = TTTTCTGTTATAGAACAGAATT

Gene: BACCELL_02471: Peptidase S54, rhomboid domain
 
Bacteroides coprophilus DSM 18228

Gene: BACCOPRO_00242: Peptidase S54, rhomboid domain
*
Bacteroides dorei DSM 17855

Site:
position = -71
score = 6.17781
sequence = TTTTCTGTTATATAACAGAATA

Gene: BACDOR_01705: Peptidase S54, rhomboid domain
*
Bacteroides eggerthii DSM 20697

Site:
position = -188
score = 5.34989
sequence = TAATATGTTACACAAAAGAAAA

Site:
position = -61
score = 5.79697
sequence = TTTTCTGTTATAGAACAGAATT

Gene: BACEGG_03101: Peptidase S54, rhomboid domain
*
Bacteroides fragilis NCTC 9343

Site:
position = -227
score = 5.04957
sequence = ATATATGTTACACAAAAGATAT

Site:
position = -105
score = 5.73991
sequence = TTTTCTGTTGTAGAACAGAATT

Gene: BF4221: Peptidase S54, rhomboid domain
*
Bacteroides ovatus ATCC 8483

Site:
position = -195
score = 5.03588
sequence = ATATATGTTACACAAAAGATTA

Site:
position = -66
score = 5.41387
sequence = TTTCATGCTTTAAAACAGAATT

Gene: BACOVA_02079: Peptidase S54, rhomboid domain
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_00187: Peptidase S54, rhomboid domain
*
Bacteroides stercoris ATCC 43183

Site:
position = -188
score = 4.34752
sequence = TTAATTGTTACACAAAAGAAAA

Site:
position = -61
score = 5.79697
sequence = TTTTCTGTTATAGAACAGAATT

Gene: BACSTE_02140: Peptidase S54, rhomboid domain
*
Bacteroides thetaiotaomicron VPI-5482

Site:
position = -192
score = 4.87887
sequence = ATATATGTTACACAAAAGATTT

Site:
position = -69
score = 4.98217
sequence = TTCCATGCTTTAAAACAGAATT

Gene: BT2831: Peptidase S54, rhomboid domain
*
Bacteroides uniformis ATCC 8492

Site:
position = -230
score = 5.03588
sequence = TAATATGTTACACAAAAGATAT

Site:
position = -97
score = 5.79697
sequence = TTTTCTGTTATAGAACAGAATT

Gene: BACUNI_03999: Peptidase S54, rhomboid domain
*
Bacteroides vulgatus ATCC 8482

Site:
position = -71
score = 6.17781
sequence = TTTTCTGTTATATAACAGAATA

Gene: BVU_0995: Peptidase S54, rhomboid domain
Peptidase S54, rhomboid domain
PF01694
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_02470: Peptidase S54, rhomboid domain
 
Bacteroides coprophilus DSM 18228

Gene: BACCOPRO_00243: Peptidase S54, rhomboid domain
 
Bacteroides dorei DSM 17855

Gene: BACDOR_01704: Peptidase S54, rhomboid domain
 
Bacteroides eggerthii DSM 20697

Gene: BACEGG_03102: Peptidase S54, rhomboid domain
 
Bacteroides fragilis NCTC 9343

Gene: BF4222: Peptidase S54, rhomboid domain
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_02080: Peptidase S54, rhomboid domain
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_00186: Peptidase S54, rhomboid domain
 
Bacteroides stercoris ATCC 43183

Gene: BACSTE_02141: Peptidase S54, rhomboid domain
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT2832: Peptidase S54, rhomboid domain
 
Bacteroides uniformis ATCC 8492

Gene: BACUNI_04000: Peptidase S54, rhomboid domain
 
Bacteroides vulgatus ATCC 8482

Gene: BVU_0994: Peptidase S54, rhomboid domain
Peptidase S54, rhomboid domain
PF03372
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_02469: Endonuclease/exonuclease/phosphatase
 
Bacteroides coprophilus DSM 18228

Gene: BACCOPRO_00244: Endonuclease/exonuclease/phosphatase
 
Bacteroides dorei DSM 17855

Gene: BACDOR_01703: Endonuclease/exonuclease/phosphatase
 
Bacteroides eggerthii DSM 20697

Gene: BACEGG_03103: Endonuclease/exonuclease/phosphatase
 
Bacteroides fragilis NCTC 9343

Gene: BF4223: Endonuclease/exonuclease/phosphatase
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_02081: Endonuclease/exonuclease/phosphatase
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183

Gene: BACSTE_02142: Endonuclease/exonuclease/phosphatase
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT2833: Endonuclease/exonuclease/phosphatase
 
Bacteroides uniformis ATCC 8492

Gene: BACUNI_04001: Endonuclease/exonuclease/phosphatase
 
Bacteroides vulgatus ATCC 8482

Gene: BVU_0993: Endonuclease/exonuclease/phosphatase
Endonuclease/exonuclease/phosphatase
PF01432
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_02468: Peptidase M3A/M3B, thimet/oligopeptidase F
 
Bacteroides coprophilus DSM 18228

Gene: BACCOPRO_00245: Peptidase M3A/M3B, thimet/oligopeptidase F
 
Bacteroides dorei DSM 17855

Gene: BACDOR_01702: Peptidase M3A/M3B, thimet/oligopeptidase F
 
Bacteroides eggerthii DSM 20697

Gene: BACEGG_03104: Peptidase M3A/M3B, thimet/oligopeptidase F
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_02082: Peptidase M3A/M3B, thimet/oligopeptidase F
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_00184: Peptidase M3A/M3B, thimet/oligopeptidase F
 
Bacteroides stercoris ATCC 43183

Gene: BACSTE_02143: Peptidase M3A/M3B, thimet/oligopeptidase F
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT2834: Peptidase M3A/M3B, thimet/oligopeptidase F
 
Bacteroides uniformis ATCC 8492

Gene: BACUNI_04002: Peptidase M3A/M3B, thimet/oligopeptidase F
 
Bacteroides vulgatus ATCC 8482

Gene: BVU_0992: Peptidase M3A/M3B, thimet/oligopeptidase F
Peptidase M3A/M3B, thimet/oligopeptidase F
secDF
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_02467: Preprotein translocase subunits SecD-SecF
 
Bacteroides coprophilus DSM 18228

Gene: BACCOPRO_00246: Preprotein translocase subunits SecD-SecF
 
Bacteroides dorei DSM 17855

Gene: BACDOR_01701: Preprotein translocase subunits SecD-SecF
 
Bacteroides eggerthii DSM 20697

Gene: BACEGG_03105: Preprotein translocase subunits SecD-SecF
 
Bacteroides fragilis NCTC 9343

Gene: BF4225: Preprotein translocase subunits SecD-SecF
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_02083: Preprotein translocase subunits SecD-SecF
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_00183: Preprotein translocase subunits SecD-SecF
 
Bacteroides stercoris ATCC 43183

Gene: BACSTE_02144: Preprotein translocase subunits SecD-SecF
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT2835: Preprotein translocase subunits SecD-SecF
 
Bacteroides uniformis ATCC 8492

Gene: BACUNI_04003: Preprotein translocase subunits SecD-SecF
 
Bacteroides vulgatus ATCC 8482

Gene: BVU_0991: Preprotein translocase subunits SecD-SecF
Preprotein translocase subunits SecD-SecF
 
CRON 5.
BACCELL_00794
*
Bacteroides cellulosilyticus DSM 14838

Site:
position = -135
score = 6.07378
sequence = TTTTATGTTATAAAACATATTT

Gene: BACCELL_00794: hypothetical protein
 
Bacteroides coprophilus DSM 18228

Gene: BACCOPRO_00747: hypothetical protein
*
Bacteroides dorei DSM 17855

Site:
position = -33
score = 4.53713
sequence = TTTTAGGTTTAACAAATTAAAA

Gene: BACDOR_04003: hypothetical protein
*
Bacteroides eggerthii DSM 20697

Site:
position = -129
score = 5.51497
sequence = TTTTGTGTTATAAAACATATTC

Gene: BACEGG_00156: hypothetical protein
*
Bacteroides fragilis NCTC 9343

Site:
position = -151
score = 5.95002
sequence = TTTTATGTTGAATAACATATTT

Gene: BF3646: hypothetical protein
*
Bacteroides ovatus ATCC 8483

Site:
position = -135
score = 5.81011
sequence = TTTTATGCTATAAAACATATTC

Gene: BACOVA_03166: hypothetical protein
*
Bacteroides plebeius DSM 17135

Site:
position = -116
score = 5.47314
sequence = TTTTATGTTATCCAACATATTC

Gene: BACPLE_00736: hypothetical protein
*
Bacteroides stercoris ATCC 43183

Site:
position = -132
score = 5.67198
sequence = TTTTGTGTTATAAAACATAATC

Gene: BACSTE_03638: hypothetical protein
*
Bacteroides thetaiotaomicron VPI-5482

Site:
position = -135
score = 5.39099
sequence = TTTTATGCTATAAAACATATCG

Gene: BT2178: hypothetical protein
*
Bacteroides uniformis ATCC 8492

Site:
position = -125
score = 5.68567
sequence = TTTTGTGTTATAAAACATATAC

Gene: BACUNI_03316: hypothetical protein
*
Bacteroides vulgatus ATCC 8482

Site:
position = -33
score = 4.53713
sequence = TTTTAGGTTTAACAAATTAAAA

Gene: BVU_2553: hypothetical protein
hypothetical protein
 
CRON 6.
pflB
*
Bacteroides cellulosilyticus DSM 14838

Site:
position = -107
score = 6.04252
sequence = TTTTATGTCGTACAACATAAAA

Gene: BACCELL_03929: Pyruvate formate-lyase (EC 2.3.1.54)
 
Bacteroides coprophilus DSM 18228

Gene: BACCOPRO_00555: Pyruvate formate-lyase (EC 2.3.1.54)
 
Bacteroides dorei DSM 17855

Gene: BACDOR_04432: Pyruvate formate-lyase (EC 2.3.1.54)
*
Bacteroides eggerthii DSM 20697

Site:
position = -4
score = 6.05942
sequence = TTTTATGTTCTTCAGCATAAAA

Gene: BACEGG_01611: Pyruvate formate-lyase (EC 2.3.1.54)
*
Bacteroides fragilis NCTC 9343

Site:
position = -107
score = 6.28325
sequence = TTTTATGCTATTCAACATAAAA

Gene: BF1323: Pyruvate formate-lyase (EC 2.3.1.54)
*
Bacteroides ovatus ATCC 8483

Site:
position = -113
score = 6.14939
sequence = TTTTATGTTGAAAAGCATAAAA

Gene: BACOVA_05597: Pyruvate formate-lyase (EC 2.3.1.54)
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_01859: Pyruvate formate-lyase (EC 2.3.1.54)
*
Bacteroides stercoris ATCC 43183

Site:
position = -116
score = 6.05942
sequence = TTTTATGCTCTTCAACATAAAA

Gene: BACSTE_00806: Pyruvate formate-lyase (EC 2.3.1.54)
*
Bacteroides thetaiotaomicron VPI-5482

Site:
position = -114
score = 6.14939
sequence = TTTTATGTTGAAAAGCATAAAA

Gene: BT4738: Pyruvate formate-lyase (EC 2.3.1.54)
*
Bacteroides uniformis ATCC 8492

Site:
position = -117
score = 6.22618
sequence = TTTTATGCTGTTCAACATAAAA

Gene: BACUNI_04526: Pyruvate formate-lyase (EC 2.3.1.54)
 
Bacteroides vulgatus ATCC 8482

Gene: BVU_2880: Pyruvate formate-lyase (EC 2.3.1.54)
Pyruvate formate-lyase (EC 2.3.1.54)
pflA
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_03928: Pyruvate formate-lyase activating enzyme (EC 1.97.1.4)
 
Bacteroides coprophilus DSM 18228

Gene: BACCOPRO_00554: Pyruvate formate-lyase activating enzyme (EC 1.97.1.4)
 
Bacteroides dorei DSM 17855

Gene: BACDOR_04431: Pyruvate formate-lyase activating enzyme (EC 1.97.1.4)
 
Bacteroides eggerthii DSM 20697

Gene: BACEGG_01610: Pyruvate formate-lyase activating enzyme (EC 1.97.1.4)
 
Bacteroides fragilis NCTC 9343

Gene: BF1322: Pyruvate formate-lyase activating enzyme (EC 1.97.1.4)
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_05596: Pyruvate formate-lyase activating enzyme (EC 1.97.1.4)
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_01858: Pyruvate formate-lyase activating enzyme (EC 1.97.1.4)
 
Bacteroides stercoris ATCC 43183

Gene: BACSTE_00807: Pyruvate formate-lyase activating enzyme (EC 1.97.1.4)
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT4737: Pyruvate formate-lyase activating enzyme (EC 1.97.1.4)
 
Bacteroides uniformis ATCC 8492

Gene: BACUNI_04527: Pyruvate formate-lyase activating enzyme (EC 1.97.1.4)
 
Bacteroides vulgatus ATCC 8482

Gene: BVU_2879: Pyruvate formate-lyase activating enzyme (EC 1.97.1.4)
Pyruvate formate-lyase activating enzyme (EC 1.97.1.4)
 
CRON 7.
PF09719
*
Bacteroides cellulosilyticus DSM 14838

Site:
position = -142
score = 5.58512
sequence = TTTTATGACATATAACATAAAA

Site:
position = -110
score = 5.76102
sequence = TAATGTGTTATATAACATAAAT

Gene: BACCELL_04404: Putative redox-active protein (C_GCAxxG_C_C)
 
Bacteroides coprophilus DSM 18228

Gene: BACCOPRO_00412: Putative redox-active protein (C_GCAxxG_C_C)
*
Bacteroides dorei DSM 17855

Site:
position = -110
score = 4.5762
sequence = AAAAGTGTTGAATAACATAATT

Gene: BACDOR_00927: Putative redox-active protein (C_GCAxxG_C_C)
*
Bacteroides eggerthii DSM 20697

Site:
position = -109
score = 5.55836
sequence = TAACGTGTTATATAACATAAAA

Gene: BACEGG_02494: Putative redox-active protein (C_GCAxxG_C_C)
*
Bacteroides fragilis NCTC 9343

Site:
position = -99
score = 5.86502
sequence = TAATCTGTTATATAACATAATT

Gene: BF2582: Putative redox-active protein (C_GCAxxG_C_C)
*
Bacteroides ovatus ATCC 8483

Site:
position = -107
score = 5.31853
sequence = TAAAGTGTTATATAACATAAAA

Gene: BACOVA_02257: Putative redox-active protein (C_GCAxxG_C_C)
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_02921: Putative redox-active protein (C_GCAxxG_C_C)
*
Bacteroides stercoris ATCC 43183

Site:
position = -110
score = 5.40688
sequence = TAACGTGCTATATAACATAAAA

Gene: BACSTE_01186: Putative redox-active protein (C_GCAxxG_C_C)
 
Bacteroides thetaiotaomicron VPI-5482
*
Bacteroides uniformis ATCC 8492

Site:
position = -105
score = 5.34429
sequence = TAACGTGTTGTATAACATAAAT

Gene: BACUNI_02281: Putative redox-active protein (C_GCAxxG_C_C)
*
Bacteroides vulgatus ATCC 8482

Site:
position = -104
score = 4.5762
sequence = AAAAGTGTTGAATAACATAATT

Gene: BVU_3908: Putative redox-active protein (C_GCAxxG_C_C)
Putative redox-active protein (C_GCAxxG_C_C)
 
CRON 8.
fucR
*
Bacteroides cellulosilyticus DSM 14838

Site:
position = -124
score = 5.2163
sequence = TTATATGCTGCAAAACATATCC

Gene: BACCELL_04988: Transcriptional regulator of fucose utilization, GntR family
 
Bacteroides coprophilus DSM 18228
*
Bacteroides dorei DSM 17855

Site:
position = -114
score = 5.14649
sequence = TCTTGTGTTATAAAACATACCA

Gene: BACDOR_02265: Transcriptional regulator of fucose utilization, GntR family
 
Bacteroides eggerthii DSM 20697
*
Bacteroides fragilis NCTC 9343

Site:
position = -114
score = 5.59933
sequence = TTTGATGTTGTATAACATACCA

Gene: BF0210: Transcriptional regulator of fucose utilization, GntR family
*
Bacteroides ovatus ATCC 8483

Site:
position = -100
score = 5.77773
sequence = TTTTCTGCTATAAAACATATCA

Gene: BACOVA_03849: Transcriptional regulator of fucose utilization, GntR family
*
Bacteroides plebeius DSM 17135

Site:
position = -93
score = 4.58841
sequence = AAATCTGTTCTTAAACATAGCT

Gene: BACPLE_02898: Transcriptional regulator of fucose utilization, GntR family
 
Bacteroides stercoris ATCC 43183
*
Bacteroides thetaiotaomicron VPI-5482

Site:
position = -100
score = 5.45775
sequence = TTTCCTGCTATAGAACATATTA

Gene: BT1272: Transcriptional regulator of fucose utilization, GntR family
 
Bacteroides uniformis ATCC 8492
*
Bacteroides vulgatus ATCC 8482

Site:
position = -114
score = 4.98948
sequence = TCTTGTGTTATAAAACATACCT

Gene: BVU_1374: Transcriptional regulator of fucose utilization, GntR family
Transcriptional regulator of fucose utilization, GntR family
fucI
 2
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_04986: L-fucose isomerase (EC 5.3.1.25)

Gene: BACCELL_04985: L-fucose isomerase (EC 5.3.1.25)
 
Bacteroides coprophilus DSM 18228

Gene: BACCOPRO_03383: L-fucose isomerase (EC 5.3.1.25)
 
Bacteroides dorei DSM 17855

Gene: BACDOR_02264: L-fucose isomerase (EC 5.3.1.25)
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343

Gene: BF0211: L-fucose isomerase (EC 5.3.1.25)
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_03850: L-fucose isomerase (EC 5.3.1.25)
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_02897: L-fucose isomerase (EC 5.3.1.25)
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT1273: L-fucose isomerase (EC 5.3.1.25)
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482

Gene: BVU_1373: L-fucose isomerase (EC 5.3.1.25)
L-fucose isomerase (EC 5.3.1.25)
fucA
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_04984: L-fuculose phosphate aldolase (EC 4.1.2.17)
 
Bacteroides coprophilus DSM 18228

Gene: BACCOPRO_03381: L-fuculose phosphate aldolase (EC 4.1.2.17)
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343

Gene: BF0213: L-fuculose phosphate aldolase (EC 4.1.2.17)
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_03851: L-fuculose phosphate aldolase (EC 4.1.2.17)
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_02896: L-fuculose phosphate aldolase (EC 4.1.2.17)
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT1274: L-fuculose phosphate aldolase (EC 4.1.2.17)
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
L-fuculose phosphate aldolase (EC 4.1.2.17)
fucK
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_04983: L-fuculokinase (EC 2.7.1.51)
 
Bacteroides coprophilus DSM 18228

Gene: BACCOPRO_03380: L-fuculokinase (EC 2.7.1.51)
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343

Gene: BF0214: L-fuculokinase (EC 2.7.1.51)
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_03852: L-fuculokinase (EC 2.7.1.51)
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_02895: L-fuculokinase (EC 2.7.1.51)
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT1275: L-fuculokinase (EC 2.7.1.51)
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
L-fuculokinase (EC 2.7.1.51)
fucU
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_04982: Possible alternative L-fucose mutarotase
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_03853: Possible alternative L-fucose mutarotase
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT1276: Possible alternative L-fucose mutarotase
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
Possible alternative L-fucose mutarotase
fucP
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_04981: L-fucose permease
 
Bacteroides coprophilus DSM 18228

Gene: BACCOPRO_03379: L-fucose permease
 
Bacteroides dorei DSM 17855

Gene: BACDOR_02263: L-fucose permease
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343

Gene: BF0215: L-fucose permease
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_03854: L-fucose permease
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_02894: L-fucose permease
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT1277: L-fucose permease
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482

Gene: BVU_1372: L-fucose permease
L-fucose permease
fucO
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides coprophilus DSM 18228

Gene: BACCOPRO_03382: Lactaldehyde reductase (EC 1.1.1.77)
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343

Gene: BF0212: Lactaldehyde reductase (EC 1.1.1.77)
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
Lactaldehyde reductase (EC 1.1.1.77)
 
CRON 9.
PF10438
 
Bacteroides cellulosilyticus DSM 14838
*
Bacteroides coprophilus DSM 18228

Site:
position = -53
score = 5.45147
sequence = TAATATGTTGGAAAACATATAA

Gene: BACCOPRO_03681: Cyclo-malto-dextrinase C-terminal domain, involved in stabilisation of acitve sites
*
Bacteroides dorei DSM 17855

Site:
position = -58
score = 5.37802
sequence = AGATATGCTGAAAAACATATAA

Gene: BACDOR_03939: Cyclo-malto-dextrinase C-terminal domain, involved in stabilisation of acitve sites
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_02836: Cyclo-malto-dextrinase C-terminal domain, involved in stabilisation of acitve sites
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482
 
Bacteroides uniformis ATCC 8492
*
Bacteroides vulgatus ATCC 8482

Site:
position = -58
score = 5.37802
sequence = AGATATGCTGAAAAACATATAA

Gene: BVU_2487: Cyclo-malto-dextrinase C-terminal domain, involved in stabilisation of acitve sites
Cyclo-malto-dextrinase C-terminal domain, involved in stabilisation of acitve sites
 
CRON 10.
susC_Rgu-1
*
Bacteroides cellulosilyticus DSM 14838

Site:
position = -184
score = 5.75749
sequence = TTTTCTGTTATATAACATCATT

Gene: BACCELL_03135: TonB-dependent outer membrane transporter of rhamnogalacturonan oligomers
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
*
Bacteroides eggerthii DSM 20697

Site:
position = -185
score = 5.28078
sequence = ATTTCTGCTTTACAACATACTC

Gene: BACEGG_00870: TonB-dependent outer membrane transporter of rhamnogalacturonan oligomers
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT4114: TonB-dependent outer membrane transporter of rhamnogalacturonan oligomers
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
TonB-dependent outer membrane transporter of rhamnogalacturonan oligomers
susD_Rgu-1
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_03134: Outer membrane polysaccharide binding protein for rhamnogalacturonan oligomers
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697

Gene: BACEGG_00869: Outer membrane polysaccharide binding protein for rhamnogalacturonan oligomers
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT4113: Outer membrane polysaccharide binding protein for rhamnogalacturonan oligomers
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
Outer membrane polysaccharide binding protein for rhamnogalacturonan oligomers
BT4112
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_03133: Predicted pectin lyase
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697

Gene: BACEGG_00868: Predicted pectin lyase
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT4112: Predicted pectin lyase
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
Predicted pectin lyase
 
CRON 11.
BT1272
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
*
Bacteroides fragilis NCTC 9343

Site:
position = -90
score = 5.71151
sequence = TATTATGTTACAAAACATATAC

Gene: BF0315: Transcriptional regulator, GntR family
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
*
Bacteroides thetaiotaomicron VPI-5482

Site:
position = -77
score = 4.76959
sequence = CTGTATGTTGTAAAACACATAC

Gene: BT2096: Transcriptional regulator, GntR family
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
Transcriptional regulator, GntR family
 
CRON 12.
xylD
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_00858: Endo-1,4-beta-xylanase D
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855

Gene: BACDOR_01276: Endo-1,4-beta-xylanase D
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_03732: Endo-1,4-beta-xylanase D
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT3675: Endo-1,4-beta-xylanase D
*
Bacteroides uniformis ATCC 8492

Site:
position = -91
score = 5.53279
sequence = GTATATGTTACACAACATATAC

Gene: BACUNI_03327: Endo-1,4-beta-xylanase D
 
Bacteroides vulgatus ATCC 8482

Gene: BVU_0497: Endo-1,4-beta-xylanase D
Endo-1,4-beta-xylanase D
GH97
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_00859: Alpha-glucosidase, glycoside hydrolase family 97
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855

Gene: BACDOR_01718: Alpha-glucosidase, glycoside hydrolase family 97
*
Bacteroides eggerthii DSM 20697

Site:
position = -92
score = 5.17313
sequence = GTATATGTTACACAACATGTAC

Gene: BACEGG_00165: Alpha-glucosidase, glycoside hydrolase family 97
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_03484: Alpha-glucosidase, glycoside hydrolase family 97
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT3661: Alpha-glucosidase, glycoside hydrolase family 97
 
Bacteroides uniformis ATCC 8492

Gene: BACUNI_03328: Alpha-glucosidase, glycoside hydrolase family 97
 
Bacteroides vulgatus ATCC 8482

Gene: BVU_1004: Alpha-glucosidase, glycoside hydrolase family 97
Alpha-glucosidase, glycoside hydrolase family 97
 
CRON 13.
susC_Crp-4
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855

Gene: BACDOR_03230: TonB-dependent outer membrane transporter of oligosaccharides
 
Bacteroides eggerthii DSM 20697
*
Bacteroides fragilis NCTC 9343

Site:
position = -162
score = 5.39054
sequence = TTCTATGTTATTAGACATAAAA

Gene: BF0594: TonB-dependent outer membrane transporter of oligosaccharides
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
*
Bacteroides stercoris ATCC 43183

Site:
position = -162
score = 5.28741
sequence = AAACATGCTATTCAGCATAAAA

Gene: BACSTE_00464: TonB-dependent outer membrane transporter of oligosaccharides
 
Bacteroides thetaiotaomicron VPI-5482
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
TonB-dependent outer membrane transporter of oligosaccharides
susD_Crp-4
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855

Gene: BACDOR_03231: Outer membrane polysaccharide binding protein for oligosaccharides
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343

Gene: BF0595: Outer membrane polysaccharide binding protein for oligosaccharides
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183

Gene: BACSTE_00462: Outer membrane polysaccharide binding protein for oligosaccharides
 
Bacteroides thetaiotaomicron VPI-5482
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
Outer membrane polysaccharide binding protein for oligosaccharides
 
CRON 14.
susC_Crp-3
*
Bacteroides cellulosilyticus DSM 14838

Site:
position = -225
score = 5.37678
sequence = TTCTATGTTCTATAACATGCAA

Gene: BACCELL_03480: TonB-dependent outer membrane transporter of oligosaccharides
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482
*
Bacteroides uniformis ATCC 8492

Site:
position = -225
score = 4.9997
sequence = TTTTGTGTTATATAACATGTTG

Gene: BACUNI_01489: TonB-dependent outer membrane transporter of oligosaccharides
 
Bacteroides vulgatus ATCC 8482
TonB-dependent outer membrane transporter of oligosaccharides
susD_Crp-3
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_03481: Outer membrane polysaccharide binding protein for oligosaccharides
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482
 
Bacteroides uniformis ATCC 8492

Gene: BACUNI_01488: Outer membrane polysaccharide binding protein for oligosaccharides
 
Bacteroides vulgatus ATCC 8482
Outer membrane polysaccharide binding protein for oligosaccharides
BACCELL_03482
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_03482: Galactose-binding domain-like
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482
 
Bacteroides uniformis ATCC 8492

Gene: BACUNI_01487: Galactose-binding domain-like
 
Bacteroides vulgatus ATCC 8482
Galactose-binding domain-like
PF00722
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_03483: Glycoside hydrolase, family 16
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_03793: Glycoside hydrolase, family 16
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482
*
Bacteroides uniformis ATCC 8492

Site:
position = -26
score = 5.05324
sequence = ACTTATGTTGTAAAATATATAT

Gene: BACUNI_01486: Glycoside hydrolase, family 16
 
Bacteroides vulgatus ATCC 8482
Glycoside hydrolase, family 16
PF00933
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_03484: Glycoside hydrolase, family 3
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_03792: Glycoside hydrolase, family 3
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482
 
Bacteroides uniformis ATCC 8492

Gene: BACUNI_01484: Glycoside hydrolase, family 3
 
Bacteroides vulgatus ATCC 8482
Glycoside hydrolase, family 3
PF02836
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482
 
Bacteroides uniformis ATCC 8492

Gene: BACUNI_01485: Glycoside hydrolase, family 2
 
Bacteroides vulgatus ATCC 8482
Glycoside hydrolase, family 2
 
CRON 15.
uxuR
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
*
Bacteroides ovatus ATCC 8483

Site:
position = -162
score = 5.26252
sequence = TCTTATGTTTAACAACATGTAT

Gene: BACOVA_00860: Predicted transcriptional regulator for glucuronate catabolism, LacI family
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_03706: Predicted transcriptional regulator for glucuronate catabolism, LacI family
 
Bacteroides stercoris ATCC 43183
*
Bacteroides thetaiotaomicron VPI-5482

Site:
position = -207
score = 5.11416
sequence = TCTTATGTTTAACAACATACGT

Gene: BT1434: Predicted transcriptional regulator for glucuronate catabolism, LacI family
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
Predicted transcriptional regulator for glucuronate catabolism, LacI family
uxuB
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_01659: D-mannonate oxidoreductase (EC 1.1.1.57)
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855

Gene: BACDOR_02114: D-mannonate oxidoreductase (EC 1.1.1.57)
 
Bacteroides eggerthii DSM 20697

Gene: BACEGG_03381: D-mannonate oxidoreductase (EC 1.1.1.57)
 
Bacteroides fragilis NCTC 9343

Gene: BF0143: D-mannonate oxidoreductase (EC 1.1.1.57)
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_00859: D-mannonate oxidoreductase (EC 1.1.1.57)
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_03707: D-mannonate oxidoreductase (EC 1.1.1.57)
 
Bacteroides stercoris ATCC 43183

Gene: BACSTE_02444: D-mannonate oxidoreductase (EC 1.1.1.57)
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT1433: D-mannonate oxidoreductase (EC 1.1.1.57)
 
Bacteroides uniformis ATCC 8492

Gene: BACUNI_01039: D-mannonate oxidoreductase (EC 1.1.1.57)
 
Bacteroides vulgatus ATCC 8482

Gene: BVU_1261: D-mannonate oxidoreductase (EC 1.1.1.57)
D-mannonate oxidoreductase (EC 1.1.1.57)
uxuA
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_01660: Mannonate dehydratase (EC 4.2.1.8)
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855

Gene: BACDOR_02115: Mannonate dehydratase (EC 4.2.1.8)
 
Bacteroides eggerthii DSM 20697

Gene: BACEGG_03380: Mannonate dehydratase (EC 4.2.1.8)
 
Bacteroides fragilis NCTC 9343

Gene: BF0142: Mannonate dehydratase (EC 4.2.1.8)
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_00858: Mannonate dehydratase (EC 4.2.1.8)
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_03708: Mannonate dehydratase (EC 4.2.1.8)
 
Bacteroides stercoris ATCC 43183

Gene: BACSTE_02442: Mannonate dehydratase (EC 4.2.1.8)
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT1432: Mannonate dehydratase (EC 4.2.1.8)
 
Bacteroides uniformis ATCC 8492

Gene: BACUNI_01040: Mannonate dehydratase (EC 4.2.1.8)
 
Bacteroides vulgatus ATCC 8482

Gene: BVU_1262: Mannonate dehydratase (EC 4.2.1.8)
Mannonate dehydratase (EC 4.2.1.8)
 
CRON 16.
susC_Crp-2
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides coprophilus DSM 18228
*
Bacteroides dorei DSM 17855

Site:
position = -338
score = 5.12548
sequence = AGATATGTTCAACAACATACTA

Gene: BACDOR_00155: putative outer membrane protein, probably involved in nutrient binding
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482
 
Bacteroides uniformis ATCC 8492
*
Bacteroides vulgatus ATCC 8482

Site:
position = -340
score = 4.86447
sequence = AGATATGTTCAACAACATAGCA

Gene: BVU_0299: putative outer membrane protein, probably involved in nutrient binding
putative outer membrane protein, probably involved in nutrient binding
susD_Crp-2
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855

Gene: BACDOR_00154: Outer membrane polysaccharide binding protein for oligosaccharides
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482

Gene: BVU_0300: Outer membrane polysaccharide binding protein for oligosaccharides
Outer membrane polysaccharide binding protein for oligosaccharides
 
CRON 17.
sbp_Crp-1
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
*
Bacteroides thetaiotaomicron VPI-5482

Site:
position = -168
score = 5.69902
sequence = TTATATGTTATAGAATATAAAA

Gene: BT4080: Six-beta-propeller protein, cell surface exposed, putatively involved in polysaccharides binding
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
Six-beta-propeller protein, cell surface exposed, putatively involved in polysaccharides binding
susC_Crp-1
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT4081: TonB-dependent outer membrane transporter of oligosaccharides
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
TonB-dependent outer membrane transporter of oligosaccharides
susD_Crp-1
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT4082: Outer membrane polysaccharide binding protein for oligosaccharides
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
Outer membrane polysaccharide binding protein for oligosaccharides
BT4083
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT4083: hypothetical protein
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
hypothetical protein
BT4084
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT4084: Glycosyl hydrolase family 43, five-bladed beta-propellor domain
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
Glycosyl hydrolase family 43, five-bladed beta-propellor domain
 
CRON 18.
crp
*
Bacteroides cellulosilyticus DSM 14838

Site:
position = -33
score = 4.67415
sequence = ATTTGTGCTGTATAACACAGTT

Gene: BACCELL_03476: transcriptional regulator, Crp/Fnr family
*
Bacteroides coprophilus DSM 18228

Site:
position = -33
score = 4.62586
sequence = TTTTGTGCTTAATAACACGATT

Gene: BACCOPRO_01276: transcriptional regulator, Crp/Fnr family
*
Bacteroides dorei DSM 17855

Site:
position = -35
score = 4.14773
sequence = ATTTGTGCTCTATAACACGGTT

Gene: BACDOR_01607: transcriptional regulator, Crp/Fnr family
*
Bacteroides eggerthii DSM 20697

Site:
position = -33
score = 4.61709
sequence = ATTTGTGCTGTACAACACAGTT

Gene: BACEGG_01340: transcriptional regulator, Crp/Fnr family
*
Bacteroides fragilis NCTC 9343

Site:
position = -33
score = 4.59737
sequence = ATTTGTGCTTTATAACACAGTT

Gene: BF0954: transcriptional regulator, Crp/Fnr family
*
Bacteroides ovatus ATCC 8483

Site:
position = -33
score = 4.83116
sequence = TTTTGTGCTGTATAACACAGTT

Gene: BACOVA_05152: transcriptional regulator, Crp/Fnr family
*
Bacteroides plebeius DSM 17135

Site:
position = -16
score = 4.08212
sequence = CTTTGTGCTTAATAACATGGTT

Gene: BACPLE_02167: transcriptional regulator, Crp/Fnr family
*
Bacteroides stercoris ATCC 43183

Site:
position = -33
score = 4.61709
sequence = ATTTGTGCTGTACAACACAGTT

Gene: BACSTE_03515: transcriptional regulator, Crp/Fnr family
*
Bacteroides thetaiotaomicron VPI-5482

Site:
position = -33
score = 4.83116
sequence = TTTTGTGCTGTATAACACAGTT

Gene: BT4338: transcriptional regulator, Crp/Fnr family
*
Bacteroides uniformis ATCC 8492

Site:
position = -33
score = 4.67415
sequence = ATTTGTGCTGTATAACACAGTT

Gene: BACUNI_04721: transcriptional regulator, Crp/Fnr family
*
Bacteroides vulgatus ATCC 8482

Site:
position = -35
score = 4.14773
sequence = ATTTGTGCTCTATAACACGGTT

Gene: BVU_3580: transcriptional regulator, Crp/Fnr family
transcriptional regulator, Crp/Fnr family
hex
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_03475: Beta-hexosaminidase (EC 3.2.1.52)
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855

Gene: BACDOR_03491: Beta-hexosaminidase (EC 3.2.1.52)
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343

Gene: BF0953: Beta-hexosaminidase (EC 3.2.1.52)
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_05141: Beta-hexosaminidase (EC 3.2.1.52)
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT4337: Beta-hexosaminidase (EC 3.2.1.52)
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482

Gene: BVU_2209: Beta-hexosaminidase (EC 3.2.1.52)
Beta-hexosaminidase (EC 3.2.1.52)
 
CRON 19.
COG3533
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
*
Bacteroides fragilis NCTC 9343

Site:
position = -143
score = 5.71151
sequence = GTATATGTTTTGTAACATAATA

Gene: BF0316: Six-hairpin glycosidase-like, COG3533 family
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
*
Bacteroides thetaiotaomicron VPI-5482

Site:
position = -111
score = 4.76959
sequence = GTATGTGTTTTACAACATACAG

Gene: BT2097: Six-hairpin glycosidase-like, COG3533 family
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
Six-hairpin glycosidase-like, COG3533 family
BF0317
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343

Gene: BF0317: Alpha-N-arabinofuranosidase (EC 3.2.1.55)
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
Alpha-N-arabinofuranosidase (EC 3.2.1.55)
BF0318
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343

Gene: BF0318: Alpha-rhamnosidase
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
Alpha-rhamnosidase
 
CRON 20.
araM
*
Bacteroides cellulosilyticus DSM 14838

Site:
position = -105
score = 6.01606
sequence = TTTTATGTTACATAACATATAC

Gene: BACCELL_05604: Aldose 1-epimerase (EC 5.1.3.3), L-arabinose mutarotase
 
Bacteroides coprophilus DSM 18228
*
Bacteroides dorei DSM 17855

Site:
position = -104
score = 5.58788
sequence = TTTTATGTTGCACAACATACTC

Gene: BACDOR_03634: Aldose 1-epimerase (EC 5.1.3.3), L-arabinose mutarotase
*
Bacteroides eggerthii DSM 20697

Site:
position = -105
score = 6.1419
sequence = TTTTATGTTACATAACATACAA

Gene: BACEGG_01536: Aldose 1-epimerase (EC 5.1.3.3), L-arabinose mutarotase
 
Bacteroides fragilis NCTC 9343
*
Bacteroides ovatus ATCC 8483

Site:
position = -105
score = 5.86264
sequence = ATTTATGCTGCACAACATATAA

Gene: BACOVA_01715: Aldose 1-epimerase (EC 5.1.3.3), L-arabinose mutarotase
*
Bacteroides plebeius DSM 17135

Site:
position = -89
score = 4.91226
sequence = TTCTATGTTGAAAAACATCTGA

Gene: BACPLE_02214: Aldose 1-epimerase (EC 5.1.3.3), L-arabinose mutarotase
 
Bacteroides stercoris ATCC 43183
*
Bacteroides thetaiotaomicron VPI-5482

Site:
position = -105
score = 6.17112
sequence = TTTTATGTTGCACAACATATAA

Gene: BT0356: Aldose 1-epimerase (EC 5.1.3.3), L-arabinose mutarotase
*
Bacteroides uniformis ATCC 8492

Site:
position = -48
score = 5.70651
sequence = ACTTATGTTGCATAACATATAA

Gene: BACUNI_01357: Aldose 1-epimerase (EC 5.1.3.3), L-arabinose mutarotase
*
Bacteroides vulgatus ATCC 8482

Site:
position = -104
score = 5.58788
sequence = TTTTATGTTGCACAACATACTC

Gene: BVU_2324: Aldose 1-epimerase (EC 5.1.3.3), L-arabinose mutarotase
Aldose 1-epimerase (EC 5.1.3.3), L-arabinose mutarotase
araP
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_05605: Predicted sodium-dependent arabinose transporter
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855

Gene: BACDOR_03633: Predicted sodium-dependent arabinose transporter
 
Bacteroides eggerthii DSM 20697

Gene: BACEGG_01535: Predicted sodium-dependent arabinose transporter
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_01714: Predicted sodium-dependent arabinose transporter
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_02216: Predicted sodium-dependent arabinose transporter
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT0355: Predicted sodium-dependent arabinose transporter
 
Bacteroides uniformis ATCC 8492

Gene: BACUNI_01358: Predicted sodium-dependent arabinose transporter
 
Bacteroides vulgatus ATCC 8482

Gene: BVU_2323: Predicted sodium-dependent arabinose transporter
Predicted sodium-dependent arabinose transporter
araR
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_05606: Predicted transcriptional regulator for arabinose utilization, NrtR family
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855

Gene: BACDOR_03632: Predicted transcriptional regulator for arabinose utilization, NrtR family
 
Bacteroides eggerthii DSM 20697

Gene: BACEGG_01534: Predicted transcriptional regulator for arabinose utilization, NrtR family
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_01713: Predicted transcriptional regulator for arabinose utilization, NrtR family
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_02213: Predicted transcriptional regulator for arabinose utilization, NrtR family
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT0354: Predicted transcriptional regulator for arabinose utilization, NrtR family
 
Bacteroides uniformis ATCC 8492

Gene: BACUNI_01359: Predicted transcriptional regulator for arabinose utilization, NrtR family
 
Bacteroides vulgatus ATCC 8482

Gene: BVU_2322: Predicted transcriptional regulator for arabinose utilization, NrtR family
Predicted transcriptional regulator for arabinose utilization, NrtR family
araD
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_05607: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855

Gene: BACDOR_03631: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
 
Bacteroides eggerthii DSM 20697

Gene: BACEGG_01533: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_01712: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_02212: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT0353: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
 
Bacteroides uniformis ATCC 8492

Gene: BACUNI_01360: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
 
Bacteroides vulgatus ATCC 8482

Gene: BVU_2321: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
BT0352
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT0352: hypothetical protein
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
hypothetical protein
araA
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_05608: L-arabinose isomerase (EC 5.3.1.4)
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855

Gene: BACDOR_03630: L-arabinose isomerase (EC 5.3.1.4)
 
Bacteroides eggerthii DSM 20697

Gene: BACEGG_01532: L-arabinose isomerase (EC 5.3.1.4)
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_01711: L-arabinose isomerase (EC 5.3.1.4)
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_02211: L-arabinose isomerase (EC 5.3.1.4)
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT0351: L-arabinose isomerase (EC 5.3.1.4)
 
Bacteroides uniformis ATCC 8492

Gene: BACUNI_01361: L-arabinose isomerase (EC 5.3.1.4)
 
Bacteroides vulgatus ATCC 8482

Gene: BVU_2320: L-arabinose isomerase (EC 5.3.1.4)
L-arabinose isomerase (EC 5.3.1.4)
araB
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_05609: Ribulokinase (EC 2.7.1.16)
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855

Gene: BACDOR_03629: Ribulokinase (EC 2.7.1.16)
 
Bacteroides eggerthii DSM 20697

Gene: BACEGG_01531: Ribulokinase (EC 2.7.1.16)
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_01710: Ribulokinase (EC 2.7.1.16)
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_02210: Ribulokinase (EC 2.7.1.16)
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT0350: Ribulokinase (EC 2.7.1.16)
 
Bacteroides uniformis ATCC 8492

Gene: BACUNI_01362: Ribulokinase (EC 2.7.1.16)
 
Bacteroides vulgatus ATCC 8482

Gene: BVU_2319: Ribulokinase (EC 2.7.1.16)
Ribulokinase (EC 2.7.1.16)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD