Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog AraR - Bacteroidaceae

Properties
Regulator type: Transcription factor
Regulator family: NrtR
Regulation mode: repressor
Biological process: Arabinose utilization
Effector: Arabinose
Phylum: Bacteroidetes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 28 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bacteroides cellulosilyticus DSM 14838 14 2
Bacteroides coprophilus DSM 18228
Bacteroides dorei DSM 17855 6 1
Bacteroides eggerthii DSM 20697 7 2
Bacteroides fragilis NCTC 9343
Bacteroides ovatus ATCC 8483 10 2
Bacteroides plebeius DSM 17135 7 3
Bacteroides stercoris ATCC 43183
Bacteroides thetaiotaomicron VPI-5482 28 4
Bacteroides uniformis ATCC 8492 12 2
Bacteroides vulgatus ATCC 8482 6 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
abn3
*
Bacteroides cellulosilyticus DSM 14838

Site:
position = -39
score = 5.35733
sequence = TATGTGTATTTTTGACACCCA

Gene: BACCELL_00858: Arabinoxylan arabinofuranohydrolase, GH43 family
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482
*
Bacteroides uniformis ATCC 8492

Site:
position = -96
score = 5.21675
sequence = TAAGTGTATATGTTACACAAC

Site:
position = -46
score = 5.3574
sequence = ATAGTGTTAATTTTACACCCG

Gene: BACUNI_03327: Arabinoxylan arabinofuranohydrolase, GH43 family
 
Bacteroides vulgatus ATCC 8482
Arabinoxylan arabinofuranohydrolase, GH43 family
agaL
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_00859: alpha-glucosidase, GH97 family
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
*
Bacteroides eggerthii DSM 20697

Site:
position = -46
score = 5.67312
sequence = AAGGTGTTATTTTTACACTCT

Site:
position = -97
score = 4.97003
sequence = CAAGTGTATATGTTACACAAC

Gene: BACEGG_00165: alpha-glucosidase, GH97 family
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_03484: alpha-glucosidase, GH97 family
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482
 
Bacteroides uniformis ATCC 8492

Gene: BACUNI_03328: alpha-glucosidase, GH97 family
 
Bacteroides vulgatus ATCC 8482
alpha-glucosidase, GH97 family
abf3
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_00860: alpha-N-arabinofuranosidase, GH51 family
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
*
Bacteroides ovatus ATCC 8483

Site:
position = -138
score = 5.11486
sequence = AAAGTGTATATTTTACCCTTG

Site:
position = -94
score = 4.77728
sequence = TAAGTGTATAATTACCAATTA

Gene: BACOVA_03483: alpha-N-arabinofuranosidase, GH51 family
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482
 
Bacteroides uniformis ATCC 8492

Gene: BACUNI_03329: alpha-N-arabinofuranosidase, GH51 family
 
Bacteroides vulgatus ATCC 8482
alpha-N-arabinofuranosidase, GH51 family
SSF48208
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482
 
Bacteroides uniformis ATCC 8492

Gene: BACUNI_03330: Six-hairpin glycosidase-like
 
Bacteroides vulgatus ATCC 8482
Six-hairpin glycosidase-like
abf4
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_00861: alpha-N-arabinofuranosidase, GH51 family
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482
 
Bacteroides uniformis ATCC 8492

Gene: BACUNI_03331: alpha-N-arabinofuranosidase, GH51 family
 
Bacteroides vulgatus ATCC 8482
alpha-N-arabinofuranosidase, GH51 family
bgaL
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_00862: beta-galactosidase, GH2 family
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482
 
Bacteroides uniformis ATCC 8492

Gene: BACUNI_03332: beta-galactosidase, GH2 family
 
Bacteroides vulgatus ATCC 8482
beta-galactosidase, GH2 family
abn4
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_00863: arabinan endo-1,5-alpha-L-arabinosidase, GH43 family
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
arabinan endo-1,5-alpha-L-arabinosidase, GH43 family
 
CRON 2.
BT4163
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
*
Bacteroides thetaiotaomicron VPI-5482

Site:
position = -329
score = 5.07565
sequence = AAATTGTATTATCTACACTCT

Gene: BT4163: Fasciclin, PF02469 family
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
Fasciclin, PF02469 family
susC_Rgu-3
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT4164: TonB-dependent outer membrane transporter of rhamnogalacturonan oligosaccharides
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
TonB-dependent outer membrane transporter of rhamnogalacturonan oligosaccharides
susD_Rgu-3
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT4165: Outer membrane polysaccharide binding protein for rhamnogalacturonan oligosaccharides
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
Outer membrane polysaccharide binding protein for rhamnogalacturonan oligosaccharides
BT4166
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT4166: hypothetical protein, DUF5075, DUF5076
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
hypothetical protein, DUF5075, DUF5076
BT4167
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT4167: Fasciclin domain, PF02469 family
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
Fasciclin domain, PF02469 family
susC_Rgu-4
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT4168: TonB-dependent outer membrane transporter of rhamnogalacturonan oligosaccharides
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
TonB-dependent outer membrane transporter of rhamnogalacturonan oligosaccharides
susD_Rgu-4
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT4169: Outer membrane polysaccharide binding protein for rhamnogalacturonan oligosaccharides
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
Outer membrane polysaccharide binding protein for rhamnogalacturonan oligosaccharides
pelL
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT4170: Pectate lyase L (EC 4.2.2.2)
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
Pectate lyase L (EC 4.2.2.2)
BT4171
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT4171: hypothetical protein, PF16408 family
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
hypothetical protein, PF16408 family
 
CRON 3.
araM
*
Bacteroides cellulosilyticus DSM 14838

Site:
position = -60
score = 5.75141
sequence = AAAGTGTTACTTTTACACCCA

Site:
position = -84
score = 5.56571
sequence = CAAGTGTTACTAATACACTCA

Gene: BACCELL_05604: L-arabinose mutarotase
 
Bacteroides coprophilus DSM 18228
*
Bacteroides dorei DSM 17855

Site:
position = -122
score = 5.19825
sequence = AAAGTGTAGGAAATACACTTT

Site:
position = -59
score = 5.5794
sequence = ATAGTGTTACTTTTACACCCA

Gene: BACDOR_03634: L-arabinose mutarotase
*
Bacteroides eggerthii DSM 20697

Site:
position = -84
score = 5.71239
sequence = AAAGTGTATATATTACACCAA

Site:
position = -60
score = 5.50468
sequence = AAAGTGTTACTTTTACACCCG

Gene: BACEGG_01536: L-arabinose mutarotase
 
Bacteroides fragilis NCTC 9343
*
Bacteroides ovatus ATCC 8483

Site:
position = -84
score = 5.59526
sequence = AGAGTGTATTTGATACACCAA

Site:
position = -60
score = 5.75141
sequence = AAAGTGTTACTTTTACACCCA

Gene: BACOVA_01715: L-arabinose mutarotase
*
Bacteroides plebeius DSM 17135

Site:
position = -45
score = 5.61214
sequence = TAAGTGTTACTTTTACACCAT

Gene: BACPLE_02214: L-arabinose mutarotase
 
Bacteroides stercoris ATCC 43183
*
Bacteroides thetaiotaomicron VPI-5482

Site:
position = -84
score = 5.59526
sequence = AGAGTGTATTTGATACACCAA

Site:
position = -60
score = 5.75141
sequence = AAAGTGTTACTTTTACACCCA

Gene: BT0356: L-arabinose mutarotase
*
Bacteroides uniformis ATCC 8492

Site:
position = -27
score = 4.20302
sequence = AAAGTGTACAGCCTACACTAA

Site:
position = -3
score = 5.75141
sequence = AAAGTGTTACTTTTACACCCA

Gene: BACUNI_01357: L-arabinose mutarotase
*
Bacteroides vulgatus ATCC 8482

Site:
position = -122
score = 5.19825
sequence = AAAGTGTAGGAAATACACTTT

Site:
position = -59
score = 5.44013
sequence = ATAGTGTTACTTTTACACCAA

Gene: BVU_2324: L-arabinose mutarotase
L-arabinose mutarotase
araP
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_05605: Predicted sodium-dependent arabinose transporter, MFS family
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855

Gene: BACDOR_03633: Predicted sodium-dependent arabinose transporter, MFS family
 
Bacteroides eggerthii DSM 20697

Gene: BACEGG_01535: Predicted sodium-dependent arabinose transporter, MFS family
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_01714: Predicted sodium-dependent arabinose transporter, MFS family
*
Bacteroides plebeius DSM 17135

Site:
position = -94
score = 5.60035
sequence = TTAGTGTTACTAATACACTTT

Gene: BACPLE_02216: Predicted sodium-dependent arabinose transporter, MFS family
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT0355: Predicted sodium-dependent arabinose transporter, MFS family
 
Bacteroides uniformis ATCC 8492

Gene: BACUNI_01358: Predicted sodium-dependent arabinose transporter, MFS family
 
Bacteroides vulgatus ATCC 8482

Gene: BVU_2323: Predicted sodium-dependent arabinose transporter, MFS family
Predicted sodium-dependent arabinose transporter, MFS family
araR
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_05606: Transcriptional regulator for arabinose utilization, NrtR family
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855

Gene: BACDOR_03632: Transcriptional regulator for arabinose utilization, NrtR family
 
Bacteroides eggerthii DSM 20697

Gene: BACEGG_01534: Transcriptional regulator for arabinose utilization, NrtR family
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_01713: Transcriptional regulator for arabinose utilization, NrtR family
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_02213: Transcriptional regulator for arabinose utilization, NrtR family
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT0354: Transcriptional regulator for arabinose utilization, NrtR family
 
Bacteroides uniformis ATCC 8492

Gene: BACUNI_01359: Transcriptional regulator for arabinose utilization, NrtR family
 
Bacteroides vulgatus ATCC 8482

Gene: BVU_2322: Transcriptional regulator for arabinose utilization, NrtR family
Transcriptional regulator for arabinose utilization, NrtR family
araD
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_05607: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855

Gene: BACDOR_03631: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
 
Bacteroides eggerthii DSM 20697

Gene: BACEGG_01533: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_01712: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_02212: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT0353: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
 
Bacteroides uniformis ATCC 8492

Gene: BACUNI_01360: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
 
Bacteroides vulgatus ATCC 8482

Gene: BVU_2321: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
BT0352
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT0352: hypothetical protein
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
hypothetical protein
araA
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_05608: L-arabinose isomerase (EC 5.3.1.4)
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855

Gene: BACDOR_03630: L-arabinose isomerase (EC 5.3.1.4)
 
Bacteroides eggerthii DSM 20697

Gene: BACEGG_01532: L-arabinose isomerase (EC 5.3.1.4)
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_01711: L-arabinose isomerase (EC 5.3.1.4)
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_02211: L-arabinose isomerase (EC 5.3.1.4)
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT0351: L-arabinose isomerase (EC 5.3.1.4)
 
Bacteroides uniformis ATCC 8492

Gene: BACUNI_01361: L-arabinose isomerase (EC 5.3.1.4)
 
Bacteroides vulgatus ATCC 8482

Gene: BVU_2320: L-arabinose isomerase (EC 5.3.1.4)
L-arabinose isomerase (EC 5.3.1.4)
araB
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_05609: Ribulokinase (EC 2.7.1.16)
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855

Gene: BACDOR_03629: Ribulokinase (EC 2.7.1.16)
 
Bacteroides eggerthii DSM 20697

Gene: BACEGG_01531: Ribulokinase (EC 2.7.1.16)
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_01710: Ribulokinase (EC 2.7.1.16)
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_02210: Ribulokinase (EC 2.7.1.16)
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT0350: Ribulokinase (EC 2.7.1.16)
 
Bacteroides uniformis ATCC 8492

Gene: BACUNI_01362: Ribulokinase (EC 2.7.1.16)
 
Bacteroides vulgatus ATCC 8482

Gene: BVU_2319: Ribulokinase (EC 2.7.1.16)
Ribulokinase (EC 2.7.1.16)
COG3533
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_05610: COG3533 secreted protein
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855

Gene: BACDOR_01282: COG3533 secreted protein
 
Bacteroides eggerthii DSM 20697

Gene: BACEGG_01530: COG3533 secreted protein
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_01709: COG3533 secreted protein
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT0349: COG3533 secreted protein
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482

Gene: BVU_0490: COG3533 secreted protein
COG3533 secreted protein
abf1
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_05611: Alpha-N-arabinofuranosidase (EC 3.2.1.55), GH51 family
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855

Gene: BACDOR_00780: Alpha-N-arabinofuranosidase (EC 3.2.1.55), GH51 family
 
Bacteroides eggerthii DSM 20697

Gene: BACEGG_01529: Alpha-N-arabinofuranosidase (EC 3.2.1.55), GH51 family
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_01708: Alpha-N-arabinofuranosidase (EC 3.2.1.55), GH51 family
*
Bacteroides plebeius DSM 17135

Site:
position = -33
score = 4.35128
sequence = AAAGTGTGAAATAAACAAGTA

Site:
position = -81
score = 4.52339
sequence = AAAATGTCAAATGTACACCCA

Gene: BACPLE_02644: Alpha-N-arabinofuranosidase (EC 3.2.1.55), GH51 family
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT0348: Alpha-N-arabinofuranosidase (EC 3.2.1.55), GH51 family
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482

Gene: BVU_4054: Alpha-N-arabinofuranosidase (EC 3.2.1.55), GH51 family
Alpha-N-arabinofuranosidase (EC 3.2.1.55), GH51 family
 
CRON 4.
PF13385
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_05402: Concanavalin A-like lectin/glucanases superfamily
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
*
Bacteroides thetaiotaomicron VPI-5482

Site:
position = -167
score = 5.71599
sequence = AAAGTGTAAAAAAGACACTTA

Gene: BT0365: Concanavalin A-like lectin/glucanases superfamily
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
Concanavalin A-like lectin/glucanases superfamily
susC_Ara-1
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_05403: TonB-dependent outer membrane transporter of arabinan oligosaccharides
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT0364: TonB-dependent outer membrane transporter of arabinan oligosaccharides
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
TonB-dependent outer membrane transporter of arabinan oligosaccharides
susD_Ara-1
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_05404: Outer membrane polysaccharide binding protein for arabinan oligosaccharides
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT0363: Outer membrane polysaccharide binding protein for arabinan oligosaccharides
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
Outer membrane polysaccharide binding protein for arabinan oligosaccharides
susC_Ara-2
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_05405: TonB-dependent outer membrane transporter of arabinan oligosaccharides
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT0362: TonB-dependent outer membrane transporter of arabinan oligosaccharides
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
TonB-dependent outer membrane transporter of arabinan oligosaccharides
susD_Ara-2
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_05406: Outer membrane polysaccharide binding protein for arabinan oligosaccharides
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT0361: Outer membrane polysaccharide binding protein for arabinan oligosaccharides
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
Outer membrane polysaccharide binding protein for arabinan oligosaccharides
abn1
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_05407: Arabinan endo-1,5-alpha-L-arabinosidase
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT0360: Arabinan endo-1,5-alpha-L-arabinosidase
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
Arabinan endo-1,5-alpha-L-arabinosidase
 
CRON 5.
sbp_Ara-4
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_01899: ix-beta-propeller protein, cell surface exposed, putatively involved in arabinan binding
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
*
Bacteroides thetaiotaomicron VPI-5482

Site:
position = -229
score = 4.93051
sequence = ATAATGTAAAATCTACACTCA

Gene: BT3047: ix-beta-propeller protein, cell surface exposed, putatively involved in arabinan binding
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
ix-beta-propeller protein, cell surface exposed, putatively involved in arabinan binding
susC_Ara-4
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_01900: TonB-dependent outer membrane transporter of arabinan oligosaccharides
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT3046: TonB-dependent outer membrane transporter of arabinan oligosaccharides
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
TonB-dependent outer membrane transporter of arabinan oligosaccharides
susD_Ara-4
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_01901: Outer membrane polysaccharide binding protein for arabinan oligosaccharides
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT3045: Outer membrane polysaccharide binding protein for arabinan oligosaccharides
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
Outer membrane polysaccharide binding protein for arabinan oligosaccharides
BT3044
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_01902: Hypothetical protein, presumably involved in arabinan utilization
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT3044: Hypothetical protein, presumably involved in arabinan utilization
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
Hypothetical protein, presumably involved in arabinan utilization
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD