Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog XylR - Bacteroidaceae

Properties
Regulator type: Transcription factor
Regulator family: NrtR
Regulation mode: repressor
Biological process: Xylose utilization
Effector: Xylose
Phylum: Bacteroidetes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 43 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bacteroides cellulosilyticus DSM 14838 5 2
Bacteroides coprophilus DSM 18228
Bacteroides dorei DSM 17855 6 4
Bacteroides eggerthii DSM 20697 6 2
Bacteroides fragilis NCTC 9343 4 1
Bacteroides ovatus ATCC 8483 6 2
Bacteroides plebeius DSM 17135 4 1
Bacteroides stercoris ATCC 43183 4 2
Bacteroides thetaiotaomicron VPI-5482 6 2
Bacteroides uniformis ATCC 8492 4 1
Bacteroides vulgatus ATCC 8482 6 4
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
xylR
*
Bacteroides cellulosilyticus DSM 14838

Site:
position = -119
score = 5.76829
sequence = GATATTGTAAAATGTACGATATC

Site:
position = -200
score = 5.6437
sequence = CTTATTGTACTTCCTACAATTAC

Site:
position = -152
score = 5.70014
sequence = CATATTGTACTTTCAACGATAAG

Gene: BACCELL_04758: Predicted regulator of xylose utilization, NrtR family
 
Bacteroides coprophilus DSM 18228
*
Bacteroides dorei DSM 17855

Site:
position = -70
score = 4.85895
sequence = CATATTGTATAATAGATGATATT

Site:
position = -103
score = 5.1313
sequence = TATATTGTAGTGTATATGATAAG

Gene: BACDOR_00865: Predicted regulator of xylose utilization, NrtR family
*
Bacteroides eggerthii DSM 20697

Site:
position = -208
score = 5.10241
sequence = GTTATTGTGCCTATTACAATTAC

Site:
position = -161
score = 6.10023
sequence = CATATTGTATTTTGTACGATAAC

Site:
position = -128
score = 5.42431
sequence = GATATTGTAAAAGATATGATATG

Gene: BACEGG_02642: Predicted regulator of xylose utilization, NrtR family
*
Bacteroides fragilis NCTC 9343

Site:
position = -280
score = 5.40138
sequence = CATACCCTATAAAATACAATAAG

Site:
position = -197
score = 5.09863
sequence = CTTTCTGTACTTTCTACAATTAC

Site:
position = -150
score = 5.66167
sequence = CATATTGTTATCGATACAATAAG

Site:
position = -117
score = 5.39923
sequence = CTTAGTGTAAAATTTACGATATG

Gene: BF2354: Predicted regulator of xylose utilization, NrtR family
*
Bacteroides ovatus ATCC 8483

Site:
position = -116
score = 5.4423
sequence = CATATTGTAGAATGTATGATATG

Site:
position = -149
score = 5.42208
sequence = CATATTGTAATTCGTAAGATAAC

Site:
position = -195
score = 5.64662
sequence = GTTTTTGTACTTTATACAATTAC

Site:
position = -279
score = 6.05913
sequence = CATATCGTTTAAAATACAATAAG

Gene: BACOVA_02532: Predicted regulator of xylose utilization, NrtR family
*
Bacteroides plebeius DSM 17135

Site:
position = -147
score = 5.76348
sequence = CATATTGTATGAACTACAAAAAC

Site:
position = -114
score = 5.20014
sequence = GATATTGTATCAAATAAGATATT

Gene: BACPLE_02263: Predicted regulator of xylose utilization, NrtR family
*
Bacteroides stercoris ATCC 43183

Site:
position = -161
score = 6.25464
sequence = CATATTGTATTTTATACGATAAC

Site:
position = -208
score = 5.50095
sequence = GTTATTGTATCTGCTACAATTAC

Site:
position = -128
score = 5.83882
sequence = GATATTGTAAGATATACGATATG

Gene: BACSTE_01380: Predicted regulator of xylose utilization, NrtR family
*
Bacteroides thetaiotaomicron VPI-5482

Site:
position = -150
score = 5.07643
sequence = CATATTGTAATTCAGAAGATAAC

Site:
position = -280
score = 5.88067
sequence = GATATCGTTTGAAATACAATAAG

Site:
position = -196
score = 5.6939
sequence = CTTTTTGTACTTTATACAATTAC

Site:
position = -117
score = 5.4423
sequence = CATATTGTAGATTGTATGATATG

Gene: BT0791: Predicted regulator of xylose utilization, NrtR family
*
Bacteroides uniformis ATCC 8492

Site:
position = -209
score = 5.69098
sequence = CTTATTGTACTTCCTACAATTAG

Site:
position = -161
score = 5.92556
sequence = CATATTGTATTCCATACGATAAC

Site:
position = -128
score = 5.65223
sequence = GATATTGTATAAAGTAAGATATG

Gene: BACUNI_00695: Predicted regulator of xylose utilization, NrtR family
*
Bacteroides vulgatus ATCC 8482

Site:
position = -136
score = 4.52607
sequence = GATATTGTATGATGGATGATATT

Site:
position = -169
score = 5.1313
sequence = TATATTGTAGTGTATATGATAAG

Gene: BVU_3955: Predicted regulator of xylose utilization, NrtR family
Predicted regulator of xylose utilization, NrtR family
xylB
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_04759: Xylulose kinase (EC 2.7.1.17)
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855

Gene: BACDOR_00866: Xylulose kinase (EC 2.7.1.17)
 
Bacteroides eggerthii DSM 20697

Gene: BACEGG_02643: Xylulose kinase (EC 2.7.1.17)
 
Bacteroides fragilis NCTC 9343

Gene: BF2355: Xylulose kinase (EC 2.7.1.17)
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_02533: Xylulose kinase (EC 2.7.1.17)
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_02264: Xylulose kinase (EC 2.7.1.17)
 
Bacteroides stercoris ATCC 43183

Gene: BACSTE_01381: Xylulose kinase (EC 2.7.1.17)
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT0792: Xylulose kinase (EC 2.7.1.17)
 
Bacteroides uniformis ATCC 8492

Gene: BACUNI_00694: Xylulose kinase (EC 2.7.1.17)
 
Bacteroides vulgatus ATCC 8482

Gene: BVU_3954: Xylulose kinase (EC 2.7.1.17)
Xylulose kinase (EC 2.7.1.17)
xylA
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_04760: Xylose isomerase (EC 5.3.1.5)
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855

Gene: BACDOR_00867: Xylose isomerase (EC 5.3.1.5)
 
Bacteroides eggerthii DSM 20697

Gene: BACEGG_02644: Xylose isomerase (EC 5.3.1.5)
 
Bacteroides fragilis NCTC 9343

Gene: BF2356: Xylose isomerase (EC 5.3.1.5)
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_02534: Xylose isomerase (EC 5.3.1.5)
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_02265: Xylose isomerase (EC 5.3.1.5)
 
Bacteroides stercoris ATCC 43183

Gene: BACSTE_01383: Xylose isomerase (EC 5.3.1.5)
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT0793: Xylose isomerase (EC 5.3.1.5)
 
Bacteroides uniformis ATCC 8492

Gene: BACUNI_00693: Xylose isomerase (EC 5.3.1.5)
 
Bacteroides vulgatus ATCC 8482

Gene: BVU_3953: Xylose isomerase (EC 5.3.1.5)
Xylose isomerase (EC 5.3.1.5)
xylE
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_04761: D-xylose proton-symporter XylE
 
Bacteroides coprophilus DSM 18228
*
Bacteroides dorei DSM 17855

Site:
position = -41
score = 5.87546
sequence = GTTATTGTATTTATTACGAAAAC

Gene: BACDOR_00759: D-xylose proton-symporter XylE
 
Bacteroides eggerthii DSM 20697

Gene: BACEGG_02645: D-xylose proton-symporter XylE
 
Bacteroides fragilis NCTC 9343

Gene: BF2357: D-xylose proton-symporter XylE
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_02535: D-xylose proton-symporter XylE
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_02266: D-xylose proton-symporter XylE
 
Bacteroides stercoris ATCC 43183

Gene: BACSTE_01384: D-xylose proton-symporter XylE
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT0794: D-xylose proton-symporter XylE
 
Bacteroides uniformis ATCC 8492

Gene: BACUNI_00692: D-xylose proton-symporter XylE
*
Bacteroides vulgatus ATCC 8482

Site:
position = -41
score = 5.87546
sequence = GTTATTGTATTTATTACGAAAAC

Gene: BVU_4073: D-xylose proton-symporter XylE
D-xylose proton-symporter XylE
 
CRON 2.
tkt
*2
Bacteroides cellulosilyticus DSM 14838

Site:
position = -161
score = 5.91062
sequence = CTTATTGTATTTTAAACAAGAAG

Gene: BACCELL_05612: Transketolase (EC 2.2.1.1)

Gene: BACCELL_05664: Transketolase (EC 2.2.1.1)
 
Bacteroides coprophilus DSM 18228

Gene: BACCOPRO_02883: Transketolase (EC 2.2.1.1)
 
Bacteroides dorei DSM 17855

Gene: BACDOR_03628: Transketolase (EC 2.2.1.1)
*
Bacteroides eggerthii DSM 20697

Site:
position = -166
score = 5.59985
sequence = CTTATTGTAATCAAAACAAGAAG

Gene: BACEGG_01528: Transketolase (EC 2.2.1.1)
 
Bacteroides fragilis NCTC 9343

Gene: BF1660: Transketolase (EC 2.2.1.1)
*
Bacteroides ovatus ATCC 8483

Site:
position = -128
score = 5.5626
sequence = CTTATTGTATCACAAACAAGAAG

Gene: BACOVA_01706: Transketolase (EC 2.2.1.1)
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_02209: Transketolase (EC 2.2.1.1)
*
Bacteroides stercoris ATCC 43183

Site:
position = -161
score = 5.32737
sequence = GTTATTGTATTCAAAACAGGAAG

Gene: BACSTE_01846: Transketolase (EC 2.2.1.1)
*
Bacteroides thetaiotaomicron VPI-5482

Site:
position = -162
score = 5.32202
sequence = CTTACTGTATTGTAAACAAGAAG

Gene: BT0347: Transketolase (EC 2.2.1.1)
 
Bacteroides uniformis ATCC 8492

Gene: BACUNI_01365: Transketolase (EC 2.2.1.1)
 
Bacteroides vulgatus ATCC 8482

Gene: BVU_2318: Transketolase (EC 2.2.1.1)
Transketolase (EC 2.2.1.1)
rpi
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_05665: Ribose 5-phosphate isomerase B (EC 5.3.1.6)
 
Bacteroides coprophilus DSM 18228

Gene: BACCOPRO_02882: Ribose 5-phosphate isomerase B (EC 5.3.1.6)
 
Bacteroides dorei DSM 17855

Gene: BACDOR_03627: Ribose 5-phosphate isomerase B (EC 5.3.1.6)
 
Bacteroides eggerthii DSM 20697

Gene: BACEGG_01527: Ribose 5-phosphate isomerase B (EC 5.3.1.6)
 
Bacteroides fragilis NCTC 9343

Gene: BF1659: Ribose 5-phosphate isomerase B (EC 5.3.1.6)
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_01705: Ribose 5-phosphate isomerase B (EC 5.3.1.6)
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_02208: Ribose 5-phosphate isomerase B (EC 5.3.1.6)
 
Bacteroides stercoris ATCC 43183

Gene: BACSTE_01845: Ribose 5-phosphate isomerase B (EC 5.3.1.6)
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT0346: Ribose 5-phosphate isomerase B (EC 5.3.1.6)
 
Bacteroides uniformis ATCC 8492

Gene: BACUNI_01366: Ribose 5-phosphate isomerase B (EC 5.3.1.6)
 
Bacteroides vulgatus ATCC 8482

Gene: BVU_2317: Ribose 5-phosphate isomerase B (EC 5.3.1.6)
Ribose 5-phosphate isomerase B (EC 5.3.1.6)
 
CRON 3.
GH3_Xyl
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_01413: Glycoside hydrolase family 3, candidate beta-glycosidase
 
Bacteroides coprophilus DSM 18228
*
Bacteroides dorei DSM 17855

Site:
position = -110
score = 5.57188
sequence = CTTTTCGTACAAAAAACAATATC

Gene: BACDOR_01992: Glycoside hydrolase family 3, candidate beta-glycosidase
 
Bacteroides eggerthii DSM 20697

Gene: BACEGG_02889: Glycoside hydrolase family 3, candidate beta-glycosidase
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183

Gene: BACSTE_02707: Glycoside hydrolase family 3, candidate beta-glycosidase
 
Bacteroides thetaiotaomicron VPI-5482
 
Bacteroides uniformis ATCC 8492

Gene: BACUNI_03534: Glycoside hydrolase family 3, candidate beta-glycosidase
*
Bacteroides vulgatus ATCC 8482

Site:
position = -110
score = 5.85644
sequence = CTTTTTGTATAAAAAACAATATC

Gene: BVU_1162: Glycoside hydrolase family 3, candidate beta-glycosidase
Glycoside hydrolase family 3, candidate beta-glycosidase
 
CRON 4.
SSF48208
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides coprophilus DSM 18228
*
Bacteroides dorei DSM 17855

Site:
position = -91
score = 4.60935
sequence = ATAATTGTTTTTTAGACAATAAA

Site:
position = -31
score = 5.13246
sequence = ATATTTGTACATTATACAATATC

Gene: BACDOR_04539: hypothetical Six-hairpin glycosidase-like
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482
 
Bacteroides uniformis ATCC 8492
*
Bacteroides vulgatus ATCC 8482

Site:
position = -91
score = 4.60935
sequence = ATAATTGTTTTTTAGACAATAAA

Site:
position = -31
score = 5.13246
sequence = ATATTTGTACATTATACAATATC

Gene: BVU_2979: hypothetical Six-hairpin glycosidase-like
hypothetical Six-hairpin glycosidase-like
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD