Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog FucR - Bacteroidaceae

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Fucose utilization
Effector: Fucose
Phylum: Bacteroidetes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bacteroides cellulosilyticus DSM 14838 1 1
Bacteroides coprophilus DSM 18228
Bacteroides dorei DSM 17855 3 1
Bacteroides eggerthii DSM 20697
Bacteroides fragilis NCTC 9343 6 2
Bacteroides ovatus ATCC 8483 6 1
Bacteroides plebeius DSM 17135 5 1
Bacteroides stercoris ATCC 43183
Bacteroides thetaiotaomicron VPI-5482 6 1
Bacteroides uniformis ATCC 8492
Bacteroides vulgatus ATCC 8482 3 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
fucR
*
Bacteroides cellulosilyticus DSM 14838

Site:
position = -69
score = 6.32029
sequence = CTTTGCACCAGCACAGTTCAGCACAG

Gene: BACCELL_04988: Transcriptional regulator of fucose utilization, GntR family
 
Bacteroides coprophilus DSM 18228
*
Bacteroides dorei DSM 17855

Site:
position = -59
score = 6.20682
sequence = CTTTGCATCGGGACAGTTCAGCACAG

Gene: BACDOR_02265: Transcriptional regulator of fucose utilization, GntR family
 
Bacteroides eggerthii DSM 20697
*
Bacteroides fragilis NCTC 9343

Site:
position = -59
score = 5.98007
sequence = CTTTGTATCATGATAGTTCAGCATAG

Gene: BF0210: Transcriptional regulator of fucose utilization, GntR family
*
Bacteroides ovatus ATCC 8483

Site:
position = -45
score = 6.62787
sequence = CTTTGCATCAGCATAGTTCAGCATAG

Gene: BACOVA_03849: Transcriptional regulator of fucose utilization, GntR family
*
Bacteroides plebeius DSM 17135

Site:
position = -39
score = 5.83307
sequence = CTTTGTGTCAGGATAGTTCAGCACAG

Gene: BACPLE_02898: Transcriptional regulator of fucose utilization, GntR family
 
Bacteroides stercoris ATCC 43183
*
Bacteroides thetaiotaomicron VPI-5482

Site:
position = -45
score = 6.36123
sequence = CTTTGCAACAGCATAGCTCAGCACAG

Gene: BT1272: Transcriptional regulator of fucose utilization, GntR family
 
Bacteroides uniformis ATCC 8492
*
Bacteroides vulgatus ATCC 8482

Site:
position = -59
score = 6.20682
sequence = CTTTGCATCGGGACAGTTCAGCACAG

Gene: BVU_1374: Transcriptional regulator of fucose utilization, GntR family
Transcriptional regulator of fucose utilization, GntR family
fucI
 2
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_04986: L-fucose isomerase (EC 5.3.1.25)

Gene: BACCELL_04985: L-fucose isomerase (EC 5.3.1.25)
 
Bacteroides coprophilus DSM 18228

Gene: BACCOPRO_03383: L-fucose isomerase (EC 5.3.1.25)
 
Bacteroides dorei DSM 17855

Gene: BACDOR_02264: L-fucose isomerase (EC 5.3.1.25)
 
Bacteroides eggerthii DSM 20697
*
Bacteroides fragilis NCTC 9343

Site:
position = -57
score = 5.05886
sequence = CTGTGTGTCAGCACAGGTCAGCATAG

Gene: BF0211: L-fucose isomerase (EC 5.3.1.25)
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_03850: L-fucose isomerase (EC 5.3.1.25)
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_02897: L-fucose isomerase (EC 5.3.1.25)
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT1273: L-fucose isomerase (EC 5.3.1.25)
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482

Gene: BVU_1373: L-fucose isomerase (EC 5.3.1.25)
L-fucose isomerase (EC 5.3.1.25)
fucA
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_04984: L-fuculose phosphate aldolase (EC 4.1.2.17)
 
Bacteroides coprophilus DSM 18228

Gene: BACCOPRO_03381: L-fuculose phosphate aldolase (EC 4.1.2.17)
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343

Gene: BF0213: L-fuculose phosphate aldolase (EC 4.1.2.17)
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_03851: L-fuculose phosphate aldolase (EC 4.1.2.17)
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_02896: L-fuculose phosphate aldolase (EC 4.1.2.17)
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT1274: L-fuculose phosphate aldolase (EC 4.1.2.17)
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
L-fuculose phosphate aldolase (EC 4.1.2.17)
fucK
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_04983: L-fuculokinase (EC 2.7.1.51)
 
Bacteroides coprophilus DSM 18228

Gene: BACCOPRO_03380: L-fuculokinase (EC 2.7.1.51)
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343

Gene: BF0214: L-fuculokinase (EC 2.7.1.51)
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_03852: L-fuculokinase (EC 2.7.1.51)
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_02895: L-fuculokinase (EC 2.7.1.51)
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT1275: L-fuculokinase (EC 2.7.1.51)
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
L-fuculokinase (EC 2.7.1.51)
fucU
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_04982: Possible alternative L-fucose mutarotase
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_03853: Possible alternative L-fucose mutarotase
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT1276: Possible alternative L-fucose mutarotase
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
Possible alternative L-fucose mutarotase
fucP
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_04981: L-fucose permease
 
Bacteroides coprophilus DSM 18228

Gene: BACCOPRO_03379: L-fucose permease
 
Bacteroides dorei DSM 17855

Gene: BACDOR_02263: L-fucose permease
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343

Gene: BF0215: L-fucose permease
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_03854: L-fucose permease
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_02894: L-fucose permease
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT1277: L-fucose permease
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482

Gene: BVU_1372: L-fucose permease
L-fucose permease
fucO
 
Bacteroides cellulosilyticus DSM 14838
 
Bacteroides coprophilus DSM 18228

Gene: BACCOPRO_03382: Lactaldehyde reductase (EC 1.1.1.77)
 
Bacteroides dorei DSM 17855
 
Bacteroides eggerthii DSM 20697
 
Bacteroides fragilis NCTC 9343

Gene: BF0212: Lactaldehyde reductase (EC 1.1.1.77)
 
Bacteroides ovatus ATCC 8483
 
Bacteroides plebeius DSM 17135
 
Bacteroides stercoris ATCC 43183
 
Bacteroides thetaiotaomicron VPI-5482
 
Bacteroides uniformis ATCC 8492
 
Bacteroides vulgatus ATCC 8482
Lactaldehyde reductase (EC 1.1.1.77)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD