Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog UxaR - Bacteroidaceae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Glucuronate utilization; Galacturonate utilization
Effector: Glucuronate; Galacturonate
Phylum: Bacteroidetes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 12 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bacteroides cellulosilyticus DSM 14838 3 2
Bacteroides coprophilus DSM 18228
Bacteroides dorei DSM 17855
Bacteroides eggerthii DSM 20697 3 2
Bacteroides fragilis NCTC 9343
Bacteroides ovatus ATCC 8483 3 2
Bacteroides plebeius DSM 17135
Bacteroides stercoris ATCC 43183 2 2
Bacteroides thetaiotaomicron VPI-5482 3 2
Bacteroides uniformis ATCC 8492 3 2
Bacteroides vulgatus ATCC 8482
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
uxaC
*
Bacteroides cellulosilyticus DSM 14838

Site:
position = -166
score = 6.11462
sequence = GCAAAGATACGAATTATTTT

Gene: BACCELL_04798: Uronate isomerase (EC 5.3.1.12)
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855

Gene: BACDOR_02901: Uronate isomerase (EC 5.3.1.12)
*
Bacteroides eggerthii DSM 20697

Site:
position = -166
score = 5.97342
sequence = GCAAAGATACGAATAATTTT

Gene: BACEGG_02664: Uronate isomerase (EC 5.3.1.12)
 
Bacteroides fragilis NCTC 9343

Gene: BF2382: Uronate isomerase (EC 5.3.1.12)
*
Bacteroides ovatus ATCC 8483

Site:
position = -165
score = 6.05427
sequence = GCAAATATACGAATTATTTT

Gene: BACOVA_02558: Uronate isomerase (EC 5.3.1.12)
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_00744: Uronate isomerase (EC 5.3.1.12)
*
Bacteroides stercoris ATCC 43183

Site:
position = -166
score = 6.11462
sequence = GCAAAGATACGAATTATTTT

Gene: BACSTE_01410: Uronate isomerase (EC 5.3.1.12)
*
Bacteroides thetaiotaomicron VPI-5482

Site:
position = -166
score = 6.05427
sequence = GCAAATATACGAATTATTTT

Gene: BT_0823: Uronate isomerase (EC 5.3.1.12)
*
Bacteroides uniformis ATCC 8492

Site:
position = -166
score = 6.11462
sequence = GCAAAGATACGAATTATTTT

Gene: BACUNI_00659: Uronate isomerase (EC 5.3.1.12)
 
Bacteroides vulgatus ATCC 8482

Gene: BVU_3074: Uronate isomerase (EC 5.3.1.12)
Uronate isomerase (EC 5.3.1.12)
 
CRON 2.
uxaR
*
Bacteroides cellulosilyticus DSM 14838

Site:
position = -91
score = 6.11462
sequence = AAAATAATTCGTATCTTTGC

Gene: BACCELL_04799: Predicted transcriptional regulator for galacturonate catabolism, LacI family
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855
*
Bacteroides eggerthii DSM 20697

Site:
position = -85
score = 5.97342
sequence = AAAATTATTCGTATCTTTGC

Gene: BACEGG_02665: Predicted transcriptional regulator for galacturonate catabolism, LacI family
 
Bacteroides fragilis NCTC 9343
*
Bacteroides ovatus ATCC 8483

Site:
position = -53
score = 6.05427
sequence = AAAATAATTCGTATATTTGC

Gene: BACOVA_02559: Predicted transcriptional regulator for galacturonate catabolism, LacI family
 
Bacteroides plebeius DSM 17135
*
Bacteroides stercoris ATCC 43183

Site:
position = -84
score = 6.11462
sequence = AAAATAATTCGTATCTTTGC

Gene: BACSTE_01411: Predicted transcriptional regulator for galacturonate catabolism, LacI family
*
Bacteroides thetaiotaomicron VPI-5482

Site:
position = -92
score = 6.05427
sequence = AAAATAATTCGTATATTTGC

Gene: BT0824: Predicted transcriptional regulator for galacturonate catabolism, LacI family
*
Bacteroides uniformis ATCC 8492

Site:
position = -87
score = 6.11462
sequence = AAAATAATTCGTATCTTTGC

Gene: BACUNI_00658: Predicted transcriptional regulator for galacturonate catabolism, LacI family
 
Bacteroides vulgatus ATCC 8482
Predicted transcriptional regulator for galacturonate catabolism, LacI family
uxaB
 
Bacteroides cellulosilyticus DSM 14838

Gene: BACCELL_04800: Altronate oxidoreductase (EC 1.1.1.58)
 
Bacteroides coprophilus DSM 18228
 
Bacteroides dorei DSM 17855

Gene: BACDOR_02900: Altronate oxidoreductase (EC 1.1.1.58)
 
Bacteroides eggerthii DSM 20697

Gene: BACEGG_02666: Altronate oxidoreductase (EC 1.1.1.58)
 
Bacteroides fragilis NCTC 9343
 
Bacteroides ovatus ATCC 8483

Gene: BACOVA_02560: Altronate oxidoreductase (EC 1.1.1.58)
 
Bacteroides plebeius DSM 17135

Gene: BACPLE_00745: Altronate oxidoreductase (EC 1.1.1.58)
 
Bacteroides stercoris ATCC 43183

Gene: BACSTE_01413: Altronate oxidoreductase (EC 1.1.1.58)
 
Bacteroides thetaiotaomicron VPI-5482

Gene: BT0825: Altronate oxidoreductase (EC 1.1.1.58)
 
Bacteroides uniformis ATCC 8492

Gene: BACUNI_00657: Altronate oxidoreductase (EC 1.1.1.58)
 
Bacteroides vulgatus ATCC 8482

Gene: BVU_3075: Altronate oxidoreductase (EC 1.1.1.58)
Altronate oxidoreductase (EC 1.1.1.58)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD