Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog MtlR - Streptococcaceae

Properties
Regulator type: Transcription factor
Regulator family: BglG
Regulation mode: activator
Biological process: Mannitol utilization
Effector: MtlA, mannitol-specific enzyme IICB PTS component; HPr, phosphocarrier protein
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 6 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Lactococcus lactis subsp. cremoris SK11 3 1
Lactococcus lactis subsp. lactis Il1403 3 1
Streptococcus agalactiae 2603V/R
Streptococcus dysgalactiae subsp. equisimilis GGS_124
Streptococcus equi subsp. zooepidemicus MGCS10565
Streptococcus gallolyticus UCN34 4 1
Streptococcus gordonii str. Challis substr. CH1
Streptococcus mitis B6
Streptococcus mutans UA159 4 1
Streptococcus pneumoniae TIGR4 4 1
Streptococcus pyogenes M1 GAS
Streptococcus sanguinis SK36
Streptococcus suis 05ZYH33
Streptococcus thermophilus CNRZ1066
Streptococcus uberis 0140J 4 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
mtlA
 
Lactococcus lactis subsp. cremoris SK11

Gene: LACR_0027: PTS system, mannitol-specific IIB component (EC 2.7.1.69) / PTS system, mannitol-specific IIC component (EC 2.7.1.69)
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
*
Streptococcus gallolyticus UCN34

Site:
position = -87
score = 7.21928
sequence = TTTGTCACAAATTTTGTGACAAA

Gene: GALLO_0993: PTS system, mannitol-specific IIB component (EC 2.7.1.69) / PTS system, mannitol-specific IIC component (EC 2.7.1.69)
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
*
Streptococcus mutans UA159

Site:
position = -149
score = 6.60957
sequence = TTTGGCAAAACTTTTGTGCCAAA

Gene: SMU.1185: PTS system, mannitol-specific IIB component (EC 2.7.1.69) / PTS system, mannitol-specific IIC component (EC 2.7.1.69)
*
Streptococcus pneumoniae TIGR4

Site:
position = -85
score = 6.87521
sequence = TTTGACACAAAATCTGTGACAAA

Gene: SP_0394: PTS system, mannitol-specific IIB component (EC 2.7.1.69) / PTS system, mannitol-specific IIC component (EC 2.7.1.69)
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
*
Streptococcus uberis 0140J

Site:
position = -89
score = 6.66489
sequence = TGTGTCACAGCTTTTGTGCCAAA

Gene: SUB0997: PTS system, mannitol-specific IIB component (EC 2.7.1.69) / PTS system, mannitol-specific IIC component (EC 2.7.1.69)
PTS system, mannitol-specific IIB component (EC 2.7.1.69) / PTS system, mannitol-specific IIC component (EC 2.7.1.69)
mtlR
*
Lactococcus lactis subsp. cremoris SK11

Site:
position = -551
score = 6.06395
sequence = TTTGACACAATTGTCGTCACACA

Gene: LACR_0028: Mannitol utilization transcription activator MtlR, BglG family
*
Lactococcus lactis subsp. lactis Il1403

Site:
position = -550
score = 6.4554
sequence = TCTGACACAATTGTTGTGACACA

Gene: L30901: Mannitol utilization transcription activator MtlR, BglG family
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34

Gene: GALLO_0994: Mannitol utilization transcription activator MtlR, BglG family
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159

Gene: SMU.1184c: Mannitol utilization transcription activator MtlR, BglG family
 
Streptococcus pneumoniae TIGR4

Gene: SP_0395: Mannitol utilization transcription activator MtlR, BglG family
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J

Gene: SUB0996: Mannitol utilization transcription activator MtlR, BglG family
Mannitol utilization transcription activator MtlR, BglG family
mtlF
 
Lactococcus lactis subsp. cremoris SK11

Gene: LACR_0029: PTS system, mannitol-specific IIA component (EC 2.7.1.69)
 
Lactococcus lactis subsp. lactis Il1403

Gene: L32907: PTS system, mannitol-specific IIA component (EC 2.7.1.69)
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34

Gene: GALLO_0995: PTS system, mannitol-specific IIA component (EC 2.7.1.69)
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159

Gene: SMU.1183: PTS system, mannitol-specific IIA component (EC 2.7.1.69)
 
Streptococcus pneumoniae TIGR4

Gene: SP_0396: PTS system, mannitol-specific IIA component (EC 2.7.1.69)
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J

Gene: SUB0995: PTS system, mannitol-specific IIA component (EC 2.7.1.69)
PTS system, mannitol-specific IIA component (EC 2.7.1.69)
mtlD
 
Lactococcus lactis subsp. cremoris SK11

Gene: LACR_0030: Mannitol-1-phosphate 5-dehydrogenase (EC 1.1.1.17)
 
Lactococcus lactis subsp. lactis Il1403

Gene: L33416: Mannitol-1-phosphate 5-dehydrogenase (EC 1.1.1.17)
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34

Gene: GALLO_0996: Mannitol-1-phosphate 5-dehydrogenase (EC 1.1.1.17)
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159

Gene: SMU.1182: Mannitol-1-phosphate 5-dehydrogenase (EC 1.1.1.17)
 
Streptococcus pneumoniae TIGR4

Gene: SP_0397: Mannitol-1-phosphate 5-dehydrogenase (EC 1.1.1.17)
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J

Gene: SUB0994: Mannitol-1-phosphate 5-dehydrogenase (EC 1.1.1.17)
Mannitol-1-phosphate 5-dehydrogenase (EC 1.1.1.17)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD