Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CelR - Lactobacillaceae

Properties
Regulator type: Transcription factor
Regulator family: BglG
Regulation mode: repressor
Biological process: Cellobiose utilization
Effector: CelB, cellobiose-specific PTS component EIIB; HPr, phosphocarrier protein
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 1 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Lactobacillus acidophilus NCFM
Lactobacillus brevis ATCC 367
Lactobacillus casei ATCC 334
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
Lactobacillus fermentum IFO 3956
Lactobacillus helveticus DPC 4571
Lactobacillus johnsonii NCC 533
Lactobacillus plantarum WCFS1
Lactobacillus reuteri JCM 1112
Lactobacillus rhamnosus GG
Lactobacillus sakei subsp. sakei 23K
Lactobacillus salivarius subsp. salivarius UCC118
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 6 1
Oenococcus oeni PSU-1
Pediococcus pentosaceus ATCC 25745
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
bglA
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367

Gene: LVIS_0465: 6-phospho-beta-glucosidase (EC 3.2.1.86)
 
Lactobacillus casei ATCC 334

Gene: LSEI_1778: 6-phospho-beta-glucosidase (EC 3.2.1.86)
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG

Gene: LGG_00163: 6-phospho-beta-glucosidase (EC 3.2.1.86)
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118
*
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Site:
position = -83
score = 6.83644
sequence = TTTCCGCAAGTATGAGGAAA

Gene: LEUM_0927: 6-phospho-beta-glucosidase (EC 3.2.1.86)
 
Oenococcus oeni PSU-1

Gene: OEOE_0224: 6-phospho-beta-glucosidase (EC 3.2.1.86)
 
Pediococcus pentosaceus ATCC 25745
6-phospho-beta-glucosidase (EC 3.2.1.86)
celB
 
Lactobacillus acidophilus NCFM

Gene: LBA0876: Cellobiose-specific PTS, component EIIB
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334

Gene: LSEI_1782: Cellobiose-specific PTS, component EIIB
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG

Gene: LGG_00159: Cellobiose-specific PTS, component EIIB
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Gene: LEUM_0928: Cellobiose-specific PTS, component EIIB
 
Oenococcus oeni PSU-1

Gene: OEOE_0223: Cellobiose-specific PTS, component EIIB
 
Pediococcus pentosaceus ATCC 25745
Cellobiose-specific PTS, component EIIB
celR
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Gene: LEUM_0929: Cellobiose utilization transcriptional regulator CelR, BglG family
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
Cellobiose utilization transcriptional regulator CelR, BglG family
celA
 
Lactobacillus acidophilus NCFM

Gene: LBA0877: Cellobiose-specific PTS, component EIIA
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334

Gene: LSEI_1781: Cellobiose-specific PTS, component EIIA
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG

Gene: LGG_00160: Cellobiose-specific PTS, component EIIA
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Gene: LEUM_0930: Cellobiose-specific PTS, component EIIA
 
Oenococcus oeni PSU-1

Gene: OEOE_0222: Cellobiose-specific PTS, component EIIA
 
Pediococcus pentosaceus ATCC 25745
Cellobiose-specific PTS, component EIIA
LEUM_0931
 
Lactobacillus acidophilus NCFM

Gene: LBA0878: Conserved hypothetical protein
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334

Gene: LSEI_1780: Conserved hypothetical protein
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533

Gene: LJ0183: Conserved hypothetical protein
 
Lactobacillus plantarum WCFS1
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG

Gene: LGG_00161: Conserved hypothetical protein
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Gene: LEUM_0931: Conserved hypothetical protein
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
Conserved hypothetical protein
celD
 
Lactobacillus acidophilus NCFM

Gene: LBA0879: Cellobiose-specific PTS, component EIIC
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533

Gene: LJ0184: Cellobiose-specific PTS, component EIIC
 
Lactobacillus plantarum WCFS1
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG

Gene: LGG_00162: Cellobiose-specific PTS, component EIIC
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Gene: LEUM_0932: Cellobiose-specific PTS, component EIIC
 
Oenococcus oeni PSU-1

Gene: OEOE_0221: Cellobiose-specific PTS, component EIIC
 
Pediococcus pentosaceus ATCC 25745
Cellobiose-specific PTS, component EIIC
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD