Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CelR - Streptococcaceae

Properties
Regulator type: Transcription factor
Regulator family: BglG
Regulation mode: repressor
Biological process: Cellobiose utilization
Effector: CelB, cellobiose-specific PTS component EIIB; HPr, phosphocarrier protein
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 15 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Lactococcus lactis subsp. cremoris SK11
Lactococcus lactis subsp. lactis Il1403
Streptococcus agalactiae 2603V/R
Streptococcus dysgalactiae subsp. equisimilis GGS_124 5 1
Streptococcus equi subsp. zooepidemicus MGCS10565 5 1
Streptococcus gallolyticus UCN34 6 2
Streptococcus gordonii str. Challis substr. CH1 6 2
Streptococcus mitis B6
Streptococcus mutans UA159 5 1
Streptococcus pneumoniae TIGR4 7 2
Streptococcus pyogenes M1 GAS 6 2
Streptococcus sanguinis SK36
Streptococcus suis 05ZYH33 9 2
Streptococcus thermophilus CNRZ1066
Streptococcus uberis 0140J 5 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
celF
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
*
Streptococcus suis 05ZYH33

Site:
position = -270
score = 6.00986
sequence = TTTCCGTTGTGATACGGAAA

Gene: SSU05_2079: Alpha-galactosidase/6-phospho-beta- glucosidase
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Alpha-galactosidase/6-phospho-beta- glucosidase
bglA
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_1407: 6-phospho-beta-glucosidase (EC 3.2.1.86)
 
Streptococcus equi subsp. zooepidemicus MGCS10565
*
Streptococcus gallolyticus UCN34

Site:
position = -87
score = 5.44486
sequence = TTTCCTAATAACTTAGGAAA

Gene: GALLO_1217: 6-phospho-beta-glucosidase (EC 3.2.1.86)
*
Streptococcus gordonii str. Challis substr. CH1

Site:
position = -89
score = 5.92426
sequence = TTTCCGTTTCGATATGGAAA

Gene: SGO_1582: 6-phospho-beta-glucosidase (EC 3.2.1.86)
 
Streptococcus mitis B6
 
Streptococcus mutans UA159

Gene: SMU.1601: 6-phospho-beta-glucosidase (EC 3.2.1.86)
*
Streptococcus pneumoniae TIGR4

Site:
position = -86
score = 6.16716
sequence = TTTCCTTAACAATAAGGAAA

Gene: SP_0303: 6-phospho-beta-glucosidase (EC 3.2.1.86)
*
Streptococcus pyogenes M1 GAS

Site:
position = -102
score = 5.78498
sequence = TTTCCGTGATGATAAGGAAA

Gene: SPy1328: 6-phospho-beta-glucosidase (EC 3.2.1.86)
 
Streptococcus sanguinis SK36
 3
Streptococcus suis 05ZYH33

Gene: SSU05_0184: 6-phospho-beta-glucosidase (EC 3.2.1.86)

Gene: SSU05_0185: 6-phospho-beta-glucosidase (EC 3.2.1.86)

Gene: SSU05_2078: 6-phospho-beta-glucosidase (EC 3.2.1.86)
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
6-phospho-beta-glucosidase (EC 3.2.1.86)
celO
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_1283: Predicted outer surface protein
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS

Gene: SPy1326: Predicted outer surface protein
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33

Gene: SSU05_2077: Predicted outer surface protein
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Predicted outer surface protein
 
CRON 2.
celB
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
*
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Site:
position = -83
score = 5.53688
sequence = TTGCCGTAGTGCTAAGGAAA

Gene: SDEG_1401: Cellobiose-specific PTS, component EIIB
 
Streptococcus equi subsp. zooepidemicus MGCS10565
*
Streptococcus gallolyticus UCN34

Site:
position = -93
score = 5.92582
sequence = TTTCCTTATCAAAGAGGAAA

Gene: GALLO_1213: Cellobiose-specific PTS, component EIIB
*
Streptococcus gordonii str. Challis substr. CH1

Site:
position = -96
score = 6.27651
sequence = TTTCCGTTTCGATACGGAAA

Gene: SGO_1580: Cellobiose-specific PTS, component EIIB
 
Streptococcus mitis B6
*
Streptococcus mutans UA159

Site:
position = -92
score = 5.29245
sequence = TTCCGTTTTCAATACGGAAA

Gene: SMU.1600: Cellobiose-specific PTS, component EIIB
*
Streptococcus pneumoniae TIGR4

Site:
position = -125
score = 5.68403
sequence = TTTCCATATCATTTAGGAAA

Gene: SP_0305: Cellobiose-specific PTS, component EIIB
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
*
Streptococcus uberis 0140J

Site:
position = -141
score = 4.8253
sequence = TTGCTTTTTTAATAGGGAAA

Site:
position = -100
score = 6.04989
sequence = TTTCCGCATCATTACGGAAA

Gene: SUB0529: Cellobiose-specific PTS, component EIIB
Cellobiose-specific PTS, component EIIB
celR
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_1400: Cellobiose utilization transcriptional regulator CelR, BglG family
*
Streptococcus equi subsp. zooepidemicus MGCS10565

Site:
position = -97
score = 5.31342
sequence = CTTCACAATCGATACGGAAA

Gene: Sez_1282: Cellobiose utilization transcriptional regulator CelR, BglG family
 
Streptococcus gallolyticus UCN34

Gene: GALLO_1212: Cellobiose utilization transcriptional regulator CelR, BglG family
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_1579: Cellobiose utilization transcriptional regulator CelR, BglG family
 
Streptococcus mitis B6
 
Streptococcus mutans UA159

Gene: SMU.1599: Cellobiose utilization transcriptional regulator CelR, BglG family
 2
Streptococcus pneumoniae TIGR4

Gene: SP_0307: Cellobiose utilization transcriptional regulator CelR, BglG family

Gene: SP_0306: Cellobiose utilization transcriptional regulator CelR, BglG family
*
Streptococcus pyogenes M1 GAS

Site:
position = -100
score = 5.51993
sequence = TTTCACAATCAATGCGGAAA

Gene: SPy1325: Cellobiose utilization transcriptional regulator CelR, BglG family
 
Streptococcus sanguinis SK36
*
Streptococcus suis 05ZYH33

Site:
position = -100
score = 5.69953
sequence = TTTCATTAATGATGCGGAAA

Gene: SSU05_2076: Cellobiose utilization transcriptional regulator CelR, BglG family
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J

Gene: SUB0530: Cellobiose utilization transcriptional regulator CelR, BglG family
Cellobiose utilization transcriptional regulator CelR, BglG family
celA
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_1399: Cellobiose-specific PTS, component EIIA
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34

Gene: GALLO_1211: Cellobiose-specific PTS, component EIIA
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_1578: Cellobiose-specific PTS, component EIIA
 
Streptococcus mitis B6
 
Streptococcus mutans UA159

Gene: SMU.1598: Cellobiose-specific PTS, component EIIA
 
Streptococcus pneumoniae TIGR4

Gene: SP_0308: Cellobiose-specific PTS, component EIIA
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J

Gene: SUB0531: Cellobiose-specific PTS, component EIIA
Cellobiose-specific PTS, component EIIA
PF06570
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_1398: Hypothetical membrane protein, PF06570 family
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34

Gene: GALLO_1210: Hypothetical membrane protein, PF06570 family
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_1577: Hypothetical membrane protein, PF06570 family
 
Streptococcus mitis B6
 
Streptococcus mutans UA159

Gene: SMU.1597c: Hypothetical membrane protein, PF06570 family
 
Streptococcus pneumoniae TIGR4

Gene: SP_0309: Hypothetical membrane protein, PF06570 family
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J

Gene: SUB0532: Hypothetical membrane protein, PF06570 family
Hypothetical membrane protein, PF06570 family
celD
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_1397: Cellobiose-specific PTS, component EIIC
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34

Gene: GALLO_1209: Cellobiose-specific PTS, component EIIC
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_1576: Cellobiose-specific PTS, component EIIC
 
Streptococcus mitis B6
 
Streptococcus mutans UA159

Gene: SMU.1596: Cellobiose-specific PTS, component EIIC
 
Streptococcus pneumoniae TIGR4

Gene: SP_0310: Cellobiose-specific PTS, component EIIC
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J

Gene: SUB0533: Cellobiose-specific PTS, component EIIC
Cellobiose-specific PTS, component EIIC
celB2
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_1281: Cellobiose-specific PTS, component EIIB
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS

Gene: SPy1324: Cellobiose-specific PTS, component EIIB
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33

Gene: SSU05_2075: Cellobiose-specific PTS, component EIIB
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Cellobiose-specific PTS, component EIIB
celA2
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_1280: Cellobiose-specific PTS, component EIIA
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS

Gene: SPy1323: Cellobiose-specific PTS, component EIIA
 
Streptococcus sanguinis SK36
 2
Streptococcus suis 05ZYH33

Gene: SSU05_2074: Cellobiose-specific PTS, component EIIA

Gene: SSU05_2073: Cellobiose-specific PTS, component EIIA
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Cellobiose-specific PTS, component EIIA
PF11687
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_1279: Hypothetical membrane protein, PF11687 family
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS

Gene: SPy1322: Hypothetical membrane protein, PF11687 family
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33

Gene: SSU05_2072: Hypothetical membrane protein, PF11687 family
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Hypothetical membrane protein, PF11687 family
celD2
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_1278: Cellobiose-specific PTS, component EIIC
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33

Gene: SSU05_2071: Cellobiose-specific PTS, component EIIC
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Cellobiose-specific PTS, component EIIC
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD