Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CcpN - Lactobacillaceae

Properties
Regulator type: Transcription factor
Regulator family: CcpN
Regulation mode: repressor
Biological process: Gluconeogenesis
Effector:
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 6 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Lactobacillus acidophilus NCFM
Lactobacillus brevis ATCC 367
Lactobacillus casei ATCC 334 1 1
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
Lactobacillus fermentum IFO 3956
Lactobacillus helveticus DPC 4571
Lactobacillus johnsonii NCC 533
Lactobacillus plantarum WCFS1
Lactobacillus reuteri JCM 1112
Lactobacillus rhamnosus GG 1 1
Lactobacillus sakei subsp. sakei 23K 3 2
Lactobacillus salivarius subsp. salivarius UCC118
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
Oenococcus oeni PSU-1 1 1
Pediococcus pentosaceus ATCC 25745
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
ccpN
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334

Gene: LSEI_2335: Gluconeogenesis transcriptional regulator CcpN, CcpN family
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG

Gene: LGG_02352: Gluconeogenesis transcriptional regulator CcpN, CcpN family
*
Lactobacillus sakei subsp. sakei 23K

Site:
position = -138
score = 5.43934
sequence = ATATAGTGTGTCACATTACAA

Gene: LSA1142: Gluconeogenesis transcriptional regulator CcpN, CcpN family
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
*
Oenococcus oeni PSU-1

Site:
position = -144
score = 4.44169
sequence = TAATTATGTTTAATAAAAAAA

Gene: OEOE_1329: Gluconeogenesis transcriptional regulator CcpN, CcpN family
 
Pediococcus pentosaceus ATCC 25745
Gluconeogenesis transcriptional regulator CcpN, CcpN family
yqfL
 
Lactobacillus acidophilus NCFM

Gene: LBA1206: Predicted phosphotransferase
 
Lactobacillus brevis ATCC 367

Gene: LVIS_0743: Predicted phosphotransferase
 
Lactobacillus casei ATCC 334

Gene: LSEI_1522: Predicted phosphotransferase
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Gene: LBUL_1174: Predicted phosphotransferase
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571

Gene: lhv_1306: Predicted phosphotransferase
 
Lactobacillus johnsonii NCC 533

Gene: LJ1326: Predicted phosphotransferase
 
Lactobacillus plantarum WCFS1

Gene: lp_1974: Predicted phosphotransferase
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG

Gene: LGG_01557: Predicted phosphotransferase
 2
Lactobacillus sakei subsp. sakei 23K

Gene: LSA1143: Predicted phosphotransferase

Gene: LSA0872: Predicted phosphotransferase
 
Lactobacillus salivarius subsp. salivarius UCC118

Gene: LSL_0699: Predicted phosphotransferase
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_1110: Predicted phosphotransferase
Predicted phosphotransferase
 
CRON 2.
ppdK
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367
*
Lactobacillus casei ATCC 334

Site:
position = -196
score = 4.68792
sequence = TTTTTAAATATCTCATTGAAA

Site:
position = -66
score = 5.0318
sequence = TTCAAAAATAATACATTATAA

Gene: LSEI_2334: Pyruvate phosphate dikinase (EC 2.7.9.1)
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1
 
Lactobacillus reuteri JCM 1112
*
Lactobacillus rhamnosus GG

Site:
position = -66
score = 4.66211
sequence = CTGCTAAATAATACATTATAT

Gene: LGG_02351: Pyruvate phosphate dikinase (EC 2.7.9.1)
*
Lactobacillus sakei subsp. sakei 23K

Site:
position = -55
score = 5.43934
sequence = TTGTAATGTGACACACTATAT

Gene: LSA1141: Pyruvate phosphate dikinase (EC 2.7.9.1)
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
Pyruvate phosphate dikinase (EC 2.7.9.1)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD