Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CcpN - Streptococcaceae

Properties
Regulator type: Transcription factor
Regulator family: CcpN
Regulation mode: repressor
Biological process: Gluconeogenesis
Effector:
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Lactococcus lactis subsp. cremoris SK11
Lactococcus lactis subsp. lactis Il1403
Streptococcus agalactiae 2603V/R 3 1
Streptococcus dysgalactiae subsp. equisimilis GGS_124 3 1
Streptococcus equi subsp. zooepidemicus MGCS10565
Streptococcus gallolyticus UCN34
Streptococcus gordonii str. Challis substr. CH1 4 2
Streptococcus mitis B6
Streptococcus mutans UA159
Streptococcus pneumoniae TIGR4
Streptococcus pyogenes M1 GAS
Streptococcus sanguinis SK36 4 2
Streptococcus suis 05ZYH33
Streptococcus thermophilus CNRZ1066
Streptococcus uberis 0140J 3 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
yqfL
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
*
Streptococcus agalactiae 2603V/R

Site:
position = -171
score = 5.74187
sequence = ATATAATATAACATATAAAAT

Gene: SAG1672: Predicted phosphotransferase
*
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Site:
position = -174
score = 5.41116
sequence = ATATAATGTACCATATATAAT

Gene: SDEG_1842: Predicted phosphotransferase
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34
*
Streptococcus gordonii str. Challis substr. CH1

Site:
position = -216
score = 5.72599
sequence = TTAATATGTGTTATATTAAAA

Gene: SGO_0811: Predicted phosphotransferase
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
*
Streptococcus sanguinis SK36

Site:
position = -124
score = 5.52902
sequence = TTATAATGTGTTACAAAATGA

Gene: SSA_1054: Predicted phosphotransferase
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
*
Streptococcus uberis 0140J

Site:
position = -44
score = 5.88957
sequence = ATATAATATACTATATAATAA

Gene: SUB1521: Predicted phosphotransferase
Predicted phosphotransferase
ccpN
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R

Gene: SAG1671: Gluconeogenesis transcriptional regulator CcpN, CcpN family
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_1841: Gluconeogenesis transcriptional regulator CcpN, CcpN family
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_0812: Gluconeogenesis transcriptional regulator CcpN, CcpN family
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36

Gene: SSA_1055: Gluconeogenesis transcriptional regulator CcpN, CcpN family
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J

Gene: SUB1520: Gluconeogenesis transcriptional regulator CcpN, CcpN family
Gluconeogenesis transcriptional regulator CcpN, CcpN family
ppdK
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R

Gene: SAG1670: Pyruvate phosphate dikinase (EC 2.7.9.1)
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_1840: Pyruvate phosphate dikinase (EC 2.7.9.1)
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34
*
Streptococcus gordonii str. Challis substr. CH1

Site:
position = -39
score = 5.72599
sequence = TTTTAATATAACACATATTAA

Gene: SGO_0810: Pyruvate phosphate dikinase (EC 2.7.9.1)
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
*
Streptococcus sanguinis SK36

Site:
position = -142
score = 5.52902
sequence = TCATTTTGTAACACATTATAA

Gene: SSA_1053: Pyruvate phosphate dikinase (EC 2.7.9.1)
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J

Gene: SUB1519: Pyruvate phosphate dikinase (EC 2.7.9.1)
Pyruvate phosphate dikinase (EC 2.7.9.1)
fbp
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_0813: Fructose-1,6-bisphosphatase, Bacillus type (EC 3.1.3.11)
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36

Gene: SSA_1056: Fructose-1,6-bisphosphatase, Bacillus type (EC 3.1.3.11)
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Fructose-1,6-bisphosphatase, Bacillus type (EC 3.1.3.11)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD