Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog LACR_0766 - Streptococcaceae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 3 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Lactococcus lactis subsp. cremoris SK11 6 1
Lactococcus lactis subsp. lactis Il1403
Streptococcus agalactiae 2603V/R
Streptococcus dysgalactiae subsp. equisimilis GGS_124 5 2
Streptococcus equi subsp. zooepidemicus MGCS10565
Streptococcus gallolyticus UCN34
Streptococcus gordonii str. Challis substr. CH1
Streptococcus mitis B6
Streptococcus mutans UA159
Streptococcus pneumoniae TIGR4
Streptococcus pyogenes M1 GAS
Streptococcus sanguinis SK36
Streptococcus suis 05ZYH33
Streptococcus thermophilus CNRZ1066
Streptococcus uberis 0140J
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
LACR_0761
*
Lactococcus lactis subsp. cremoris SK11

Site:
position = -35
score = 6.31715
sequence = AGAGTTTAACGTTAAACTAA

Gene: LACR_0761: Predicted polysaccharide ABC transporter, permease protein 1
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
*
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Site:
position = -121
score = 6.25168
sequence = TCGGTTTAACGATAAACTAA

Gene: SDEG_1903: Predicted polysaccharide ABC transporter, permease protein 1
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Predicted polysaccharide ABC transporter, permease protein 1
LACR_0762
 
Lactococcus lactis subsp. cremoris SK11

Gene: LACR_0762: Predicted polysaccharide ABC transporter, permease protein 2
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_1902: Predicted polysaccharide ABC transporter, permease protein 2
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Predicted polysaccharide ABC transporter, permease protein 2
LACR_0763
 
Lactococcus lactis subsp. cremoris SK11

Gene: LACR_0763: Predicted polysaccharide ABC transporter, substrate-binding protein
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_1900: Predicted polysaccharide ABC transporter, substrate-binding protein
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Predicted polysaccharide ABC transporter, substrate-binding protein
LACR_0764
 
Lactococcus lactis subsp. cremoris SK11

Gene: LACR_0764: Predicted integral membrane protein
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_1901: Predicted integral membrane protein
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Predicted integral membrane protein
LACR_0765
 
Lactococcus lactis subsp. cremoris SK11

Gene: LACR_0765: Predicted maltodextrin glucosidase (EC 3.2.1.20)
 
Lactococcus lactis subsp. lactis Il1403

Gene: L129481: Predicted maltodextrin glucosidase (EC 3.2.1.20)
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159

Gene: SMU.104: Predicted maltodextrin glucosidase (EC 3.2.1.20)
 
Streptococcus pneumoniae TIGR4

Gene: SP_0312: Predicted maltodextrin glucosidase (EC 3.2.1.20)
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Predicted maltodextrin glucosidase (EC 3.2.1.20)
LACR_0766
 
Lactococcus lactis subsp. cremoris SK11

Gene: LACR_0766: Predicted sugar utilization transcriptional regulator, LacI family
 
Lactococcus lactis subsp. lactis Il1403

Gene: L0147: Predicted sugar utilization transcriptional regulator, LacI family
 
Streptococcus agalactiae 2603V/R
*
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Site:
position = -232
score = 5.83406
sequence = TAGGTTTATCGTTAAACTAT

Gene: SDEG_1904: Predicted sugar utilization transcriptional regulator, LacI family
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Predicted sugar utilization transcriptional regulator, LacI family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD