Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog SdaR - Lactobacillaceae

Properties
Regulator type: Transcription factor
Regulator family: SdaR
Regulation mode: repressor
Biological process: Glycerate utilization
Effector: D-glycerate
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Lactobacillus acidophilus NCFM
Lactobacillus brevis ATCC 367 3 2
Lactobacillus casei ATCC 334
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
Lactobacillus fermentum IFO 3956
Lactobacillus helveticus DPC 4571
Lactobacillus johnsonii NCC 533
Lactobacillus plantarum WCFS1
Lactobacillus reuteri JCM 1112 3 2
Lactobacillus rhamnosus GG
Lactobacillus sakei subsp. sakei 23K 2 1
Lactobacillus salivarius subsp. salivarius UCC118
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
Oenococcus oeni PSU-1
Pediococcus pentosaceus ATCC 25745
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
sdaR
 
Lactobacillus acidophilus NCFM
*
Lactobacillus brevis ATCC 367

Site:
position = -190
score = 4.81468
sequence = AATTGATCAATGTAACTATG

Gene: LVIS_0411: Glycerate utilization transcriptional regulator SdaR, SdaR family
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1
*
Lactobacillus reuteri JCM 1112

Site:
position = -338
score = 4.99688
sequence = CATAGTTCCTATTATCAAAA

Gene: LAR_0599: Glycerate utilization transcriptional regulator SdaR, SdaR family
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K

Gene: LSA0710: Glycerate utilization transcriptional regulator SdaR, SdaR family
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
Glycerate utilization transcriptional regulator SdaR, SdaR family
 
CRON 2.
grtP
 
Lactobacillus acidophilus NCFM
*
Lactobacillus brevis ATCC 367

Site:
position = -123
score = 4.81468
sequence = CATAGTTACATTGATCAATT

Gene: LVIS_0412: D-glycerate transporter, GntP family
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956

Gene: LAF_0491: D-glycerate transporter, GntP family
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1
*
Lactobacillus reuteri JCM 1112

Site:
position = -172
score = 4.99688
sequence = TTTTGATAATAGGAACTATG

Gene: LAR_0600: D-glycerate transporter, GntP family
 
Lactobacillus rhamnosus GG
*
Lactobacillus sakei subsp. sakei 23K

Site:
position = -38
score = 4.86187
sequence = GATTGTGTTATATAACAAAA

Gene: LSA0711: D-glycerate transporter, GntP family
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1

Gene: OEOE_1479: D-glycerate transporter, GntP family
 
Pediococcus pentosaceus ATCC 25745
D-glycerate transporter, GntP family
garK
 
Lactobacillus acidophilus NCFM

Gene: LBA0723: Glycerate kinase (EC 2.7.1.31)
 
Lactobacillus brevis ATCC 367

Gene: LVIS_0413: Glycerate kinase (EC 2.7.1.31)
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Gene: LBUL_0949: Glycerate kinase (EC 2.7.1.31)
 
Lactobacillus fermentum IFO 3956

Gene: LAF_0492: Glycerate kinase (EC 2.7.1.31)
 
Lactobacillus helveticus DPC 4571

Gene: lhv_0764: Glycerate kinase (EC 2.7.1.31)
 
Lactobacillus johnsonii NCC 533

Gene: LJ1251: Glycerate kinase (EC 2.7.1.31)
 
Lactobacillus plantarum WCFS1
 
Lactobacillus reuteri JCM 1112

Gene: LAR_0601: Glycerate kinase (EC 2.7.1.31)
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K

Gene: LSA0712: Glycerate kinase (EC 2.7.1.31)
 
Lactobacillus salivarius subsp. salivarius UCC118

Gene: LSL_1707: Glycerate kinase (EC 2.7.1.31)
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1

Gene: OEOE_1478: Glycerate kinase (EC 2.7.1.31)
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_0955: Glycerate kinase (EC 2.7.1.31)
Glycerate kinase (EC 2.7.1.31)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD