Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog IdnR - Enterobacteriales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: activator (repressor)
Biological process: Idonate utilization
Effector: L-idonate; 5-dehydro-D-gluconate
Phylum: Proteobacteria/Gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Citrobacter koseri ATCC BAA-895 3 1
Edwardsiella tarda EIB202
Enterobacter sp. 638
Erwinia amylovora ATCC 49946
Erwinia carotovora subsp. atroseptica SCRI1043
Escherichia coli str. K-12 substr. MG1655 5 2
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
Photorhabdus luminescens subsp. laumondii TTO1
Proteus mirabilis HI4320
Salmonella typhimurium LT2 5 2
Serratia proteamaculans 568 3 2
Yersinia pestis KIM
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
idnK
 
Citrobacter koseri ATCC BAA-895
 
Edwardsiella tarda EIB202
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Erwinia carotovora subsp. atroseptica SCRI1043
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -119
score = 5.87062
sequence = CTATGTTACGCATAACGTGA

Gene: b4268: Gluconokinase (EC 2.7.1.12)
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Photorhabdus luminescens subsp. laumondii TTO1
 
Proteus mirabilis HI4320
*
Salmonella typhimurium LT2

Site:
position = -119
score = 5.93303
sequence = CAATGTTACGCATAACGTGA

Gene: STM4485: Gluconokinase (EC 2.7.1.12)
 
Serratia proteamaculans 568
 
Yersinia pestis KIM

Gene: y1646: Gluconokinase (EC 2.7.1.12)
Gluconokinase (EC 2.7.1.12)
 
CRON 2.
idnD
 
Citrobacter koseri ATCC BAA-895
 
Edwardsiella tarda EIB202
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Erwinia carotovora subsp. atroseptica SCRI1043
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -117
score = 5.87062
sequence = TCACGTTATGCGTAACATAG

Gene: b4267: L-idonate 5-dehydrogenase (EC 1.1.1.264)
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Photorhabdus luminescens subsp. laumondii TTO1
 
Proteus mirabilis HI4320
*
Salmonella typhimurium LT2

Site:
position = -117
score = 5.93303
sequence = TCACGTTATGCGTAACATTG

Gene: STM4484: L-idonate 5-dehydrogenase (EC 1.1.1.264)
 
Serratia proteamaculans 568

Gene: Spro_3287: L-idonate 5-dehydrogenase (EC 1.1.1.264)
 
Yersinia pestis KIM
L-idonate 5-dehydrogenase (EC 1.1.1.264)
idnO
*
Citrobacter koseri ATCC BAA-895

Site:
position = -39
score = 5.29997
sequence = TACAGTTACGCGTAACAGCT

Gene: CKO_02793: 5-keto-D-gluconate 5-reductase (EC 1.1.1.69)
 
Edwardsiella tarda EIB202
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Escherichia coli str. K-12 substr. MG1655

Gene: b4266: 5-keto-D-gluconate 5-reductase (EC 1.1.1.69)
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Photorhabdus luminescens subsp. laumondii TTO1
 
Proteus mirabilis HI4320
 
Salmonella typhimurium LT2

Gene: STM4483: 5-keto-D-gluconate 5-reductase (EC 1.1.1.69)
*
Serratia proteamaculans 568

Site:
position = -121
score = 5.08153
sequence = TCACGTTAAAGGTAACAGCT

Gene: Spro_3288: 5-keto-D-gluconate 5-reductase (EC 1.1.1.69)
 
Yersinia pestis KIM

Gene: y1645: 5-keto-D-gluconate 5-reductase (EC 1.1.1.69)
5-keto-D-gluconate 5-reductase (EC 1.1.1.69)
idnT
 
Citrobacter koseri ATCC BAA-895
 
Edwardsiella tarda EIB202
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Escherichia coli str. K-12 substr. MG1655

Gene: b4265: L-idonate, D-gluconate, 5-keto-D-gluconate transporter
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Photorhabdus luminescens subsp. laumondii TTO1
 
Proteus mirabilis HI4320
 
Salmonella typhimurium LT2

Gene: STM4482: L-idonate, D-gluconate, 5-keto-D-gluconate transporter
 
Serratia proteamaculans 568
 
Yersinia pestis KIM
L-idonate, D-gluconate, 5-keto-D-gluconate transporter
idnR
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_02791: Positive regulator of L-idonate catabolism
 
Edwardsiella tarda EIB202
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Escherichia coli str. K-12 substr. MG1655

Gene: b4264: Positive regulator of L-idonate catabolism
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Photorhabdus luminescens subsp. laumondii TTO1
 
Proteus mirabilis HI4320
 
Salmonella typhimurium LT2

Gene: STM4481: Positive regulator of L-idonate catabolism
*
Serratia proteamaculans 568

Site:
position = -169
score = 5.08153
sequence = AGCTGTTACCTTTAACGTGA

Gene: Spro_3289: Positive regulator of L-idonate catabolism
 
Yersinia pestis KIM

Gene: y1650: Positive regulator of L-idonate catabolism
Positive regulator of L-idonate catabolism
CKO_02792
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_02792: 2-ketogluconate transporter
 
Edwardsiella tarda EIB202
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Escherichia coli str. K-12 substr. MG1655
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Photorhabdus luminescens subsp. laumondii TTO1
 
Proteus mirabilis HI4320
 
Salmonella typhimurium LT2
 
Serratia proteamaculans 568
 
Yersinia pestis KIM
2-ketogluconate transporter
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD